Rmu_sc0000032.1_g000014

26S proteasome non-ATPase regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000032.1
Physical Location & Seq
Reverse (-)
79881 .. 80165
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000032.1_g000014.1.cds

Sequence Viewer

Length: 285 bp
atggacacattaagcagacttagccatgatgcagattcagaagtagcaatggctgcagtggtttcctttggtttgataggtgcaggaaccaataatgccagaatggctgccatgctgcgcagtctttcaagttattactacaaagatgccaaccttctcttctgtgtgcgcattgctcaaggtcttgtgcatttgggaaagggtttatcaactctaaatccatatcattccgactgcttcttgctatcaccagcagctcttggtcatgctgcacgcatatcttga

Protein Analysis

94

Amino Acids

9.99

Weight (kDa)

7.85

Isoelectric Point (pI)

29.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010697)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 2 cut(s) 119, 170
AgsI TTSAA 1 cut(s) 129
AjuI GAANNNNNNNTTGG 2 cut(s) 143, 175
AluBI AGCT 1 cut(s) 257
AluI AGCT 1 cut(s) 257
ApeKI GCWGC 5 cut(s) 53, 107, 115, 254, 269
AspLEI GCGC 2 cut(s) 120, 171
AsuHPI GGTGA 1 cut(s) 240
BbvI GCAGC 5 cut(s) 40, 94, 102, 256, 266
BfmI CTRYAG 1 cut(s) 54
BglI GCCNNNNNGGC 1 cut(s) 104
BisI GCNGC 5 cut(s) 54, 108, 116, 255, 270
BlsI GCNGC 5 cut(s) 55, 109, 117, 256, 271
BmiI GGNNCC 1 cut(s) 88
BmsI GCATC 2 cut(s) 19, 136
BpuEI CTTGAG 1 cut(s) 162
Bse3DI GCAATG 2 cut(s) 54, 171
BseMI GCAATG 2 cut(s) 54, 171
BseXI GCAGC 5 cut(s) 40, 94, 102, 256, 266
BsgI GTGCAG 2 cut(s) 102, 255
BspLI GGNNCC 1 cut(s) 88
BspMAI CTGCAG 1 cut(s) 58
BsrDI GCAATG 2 cut(s) 54, 171
Bst6I CTCTTC 1 cut(s) 164
BstAPI GCANNNNNTGC 1 cut(s) 53
BstC8I GCNNGC 1 cut(s) 274
BstDEI CTNAG 1 cut(s) 20
BstHHI GCGC 2 cut(s) 120, 171
BstMWI GCNNNNNNNGC 3 cut(s) 21, 53, 104
BstSFI CTRYAG 1 cut(s) 54
BstV1I GCAGC 5 cut(s) 40, 94, 102, 256, 266
BtsI GCAGTG 1 cut(s) 63
BtsIMutI CAGTG 1 cut(s) 63
Cac8I GCNNGC 1 cut(s) 274
CfoI GCGC 2 cut(s) 120, 171
CviAII CATG 3 cut(s) 26, 112, 266
CviJI RGCY 4 cut(s) 24, 53, 107, 257
CviKI_1 RGCY 4 cut(s) 24, 53, 107, 257
DdeI CTNAG 1 cut(s) 20
Eam1104I CTCTTC 1 cut(s) 164
EarI CTCTTC 1 cut(s) 164
FaeI CATG 3 cut(s) 29, 115, 269
FaiI YATR 5 cut(s) 27, 113, 223, 267, 278
FatI CATG 3 cut(s) 25, 111, 265
Fnu4HI GCNGC 5 cut(s) 54, 108, 116, 255, 270
Fsp4HI GCNGC 5 cut(s) 54, 108, 116, 255, 270
FspAI RTGCGCAY 1 cut(s) 170
FspI TGCGCA 2 cut(s) 119, 170
GlaI GCGC 2 cut(s) 119, 170
GluI GCNGC 5 cut(s) 54, 108, 116, 255, 270
HhaI GCGC 2 cut(s) 120, 171
Hin1II CATG 3 cut(s) 29, 115, 269
Hin6I GCGC 2 cut(s) 118, 169
HinP1I GCGC 2 cut(s) 118, 169
HinfI GANTC 1 cut(s) 35
HphI GGTGA 1 cut(s) 240
Hpy188I TCNGA 2 cut(s) 40, 232
Hpy188III TCNNGA 1 cut(s) 282
HpyAV CCTTC 1 cut(s) 164
HpyCH4V TGCA 5 cut(s) 32, 56, 83, 190, 272
HpyF10VI GCNNNNNNNGC 3 cut(s) 21, 53, 104
HpyF3I CTNAG 1 cut(s) 20
Hsp92II CATG 3 cut(s) 29, 115, 269
HspAI GCGC 2 cut(s) 118, 169
LpnPI CCDG 3 cut(s) 69, 112, 264
Lsp1109I GCAGC 5 cut(s) 40, 94, 102, 256, 266
LweI GCATC 2 cut(s) 19, 136
MboII GAAGA 1 cut(s) 151
MmeI TCCRAC 1 cut(s) 255
MseI TTAA 1 cut(s) 11
MwoI GCNNNNNNNGC 3 cut(s) 21, 53, 104
NlaIII CATG 3 cut(s) 29, 115, 269
NlaIV GGNNCC 1 cut(s) 88
NsbI TGCGCA 2 cut(s) 119, 170
PfeI GAWTC 1 cut(s) 35
PkrI GCNGC 5 cut(s) 55, 109, 117, 256, 271
PspN4I GGNNCC 1 cut(s) 88
PstI CTGCAG 1 cut(s) 58
SaqAI TTAA 1 cut(s) 11
SatI GCNGC 5 cut(s) 54, 108, 116, 255, 270
SetI ASST 4 cut(s) 82, 156, 184, 259
SfaNI GCATC 2 cut(s) 19, 136
SfcI CTRYAG 1 cut(s) 54
SmlI CTYRAG 1 cut(s) 177
SmoI CTYRAG 1 cut(s) 177
TfiI GAWTC 1 cut(s) 35
Tru1I TTAA 1 cut(s) 11
Tru9I TTAA 1 cut(s) 11
TscAI CASTG 1 cut(s) 63
TseI GCWGC 5 cut(s) 53, 107, 115, 254, 269
TspRI CASTG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.