Rw6G006980

26S proteasome non-ATPase regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Forward (+)
11149588 .. 11158381
8794 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G006980.1

Sequence Viewer

Length: 294 bp
ATGGTTGCAGAAGATGAAGAAAGAGAAGCATTGCAGGACATTATCAATAACGCTAAACTCAGTGAAGGTTATCTTACCCTTGCTCGTGCTATTGAGGTCATGGAGGCCAAAACTCCAGAAGATATTTACAAGGCACACTTACTTGATGGCCGGGCAAGTGCTGGTGCTAGTGTTGATTCAGCTAGACAGAACTTAGCTGATACGTTTGTTAATGCATTTGTCAATGCTGGCTTTGGTCAGGTAAAGTTATTCAGAATTGATTTGCCTGTGAAATGTTGTGGATTTTGGATTTAA

Protein Analysis

97

Amino Acids

10.66

Weight (kDa)

4.73

Isoelectric Point (pI)

30.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPN1_RPN2_N PF17781 4 - 47 6.4e-13 RPN1 N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010697)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 148
AluBI AGCT 2 cut(s) 182, 197
AluI AGCT 2 cut(s) 182, 197
AoxI GGCC 2 cut(s) 105, 148
AsuC2I CCSGG 1 cut(s) 152
BaeI ACNNNNGTAYC 2 cut(s) 192, 225
BauI CACGAG 1 cut(s) 84
BccI CCATC 1 cut(s) 140
BcnI CCSGG 1 cut(s) 152
BfaI CTAG 2 cut(s) 168, 183
Bme1390I CCNGG 1 cut(s) 152
BmrFI CCNGG 1 cut(s) 152
BpmI CTGGAG 1 cut(s) 99
BpuMI CCSGG 1 cut(s) 152
Bse3DI GCAATG 1 cut(s) 29
BseMI GCAATG 1 cut(s) 29
BseMII CTCAG 1 cut(s) 73
BshFI GGCC 2 cut(s) 107, 150
BsiSI CCGG 1 cut(s) 151
BsnI GGCC 2 cut(s) 107, 150
BspANI GGCC 2 cut(s) 107, 150
BspCNI CTCAG 1 cut(s) 72
BsrDI GCAATG 1 cut(s) 29
BssSI CACGAG 1 cut(s) 84
Bst2BI CACGAG 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 229
BstDEI CTNAG 2 cut(s) 59, 193
BstSCI CCNGG 1 cut(s) 150
BsuRI GGCC 2 cut(s) 107, 150
BtsIMutI CAGTG 1 cut(s) 67
Cac8I GCNNGC 1 cut(s) 229
CviAII CATG 1 cut(s) 100
CviJI RGCY 5 cut(s) 107, 150, 182, 197, 231
CviKI_1 RGCY 5 cut(s) 107, 150, 182, 197, 231
DdeI CTNAG 2 cut(s) 59, 193
EaeI YGGCCR 1 cut(s) 148
EcoT22I ATGCAT 1 cut(s) 217
FaeI CATG 1 cut(s) 103
FaiI YATR 1 cut(s) 101
FalI AAGNNNNNCTT 4 cut(s) 57, 89, 122, 154
FatI CATG 1 cut(s) 99
FspBI CTAG 2 cut(s) 168, 183
GsuI CTGGAG 1 cut(s) 99
HaeIII GGCC 2 cut(s) 107, 150
HapII CCGG 1 cut(s) 151
Hin1II CATG 1 cut(s) 103
HinfI GANTC 1 cut(s) 176
HpaII CCGG 1 cut(s) 151
Hpy188I TCNGA 1 cut(s) 254
Hpy188III TCNNGA 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 59
HpyCH4IV ACGT 1 cut(s) 203
HpyCH4V TGCA 3 cut(s) 8, 34, 215
HpyF3I CTNAG 2 cut(s) 59, 193
HpySE526I ACGT 1 cut(s) 203
Hsp92II CATG 1 cut(s) 103
LpnPI CCDG 7 cut(s) 20, 129, 147, 164, 213, 224, 279
MaeI CTAG 2 cut(s) 168, 183
MaeII ACGT 1 cut(s) 203
MboII GAAGA 3 cut(s) 23, 29, 131
MluCI AATT 1 cut(s) 255
MnlI CCTC 2 cut(s) 88, 97
Mph1103I ATGCAT 1 cut(s) 217
MseI TTAA 2 cut(s) 210, 292
MspI CCGG 1 cut(s) 151
MspR9I CCNGG 1 cut(s) 152
NciI CCSGG 1 cut(s) 152
NlaIII CATG 1 cut(s) 103
NsiI ATGCAT 1 cut(s) 217
PfeI GAWTC 1 cut(s) 176
SaqAI TTAA 2 cut(s) 210, 292
ScrFI CCNGG 1 cut(s) 152
SetI ASST 6 cut(s) 70, 99, 184, 199, 206, 243
Sse9I AATT 1 cut(s) 255
SspMI CTAG 2 cut(s) 168, 183
StyD4I CCNGG 1 cut(s) 150
TaiI ACGT 1 cut(s) 206
TasI AATT 1 cut(s) 255
TfiI GAWTC 1 cut(s) 176
Tru1I TTAA 2 cut(s) 210, 292
Tru9I TTAA 2 cut(s) 210, 292
TscAI CASTG 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 30
TspRI CASTG 1 cut(s) 67
XspI CTAG 2 cut(s) 168, 183
Zsp2I ATGCAT 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.