Rmu_sc0000042.1_g000001

Peptidase S24 S26A S26B S26C family protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000042.1
Physical Location & Seq
Forward (+)
243 .. 3360
3118 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000042.1_g000001.1.cds

Sequence Viewer

Length: 618 bp
atggtttccctatccacctggttccgatacatagcccacaagctcgaatattctgccactatcagctggaagaactataaaagaggtcaaatcacagacagagaacttggtgatgctgtttggaaaaatttgtttcagggaaagttgacatacatgcattggaataaaggagcagagatggcccctagtataggggagcaagggggaactctccttgtcaggaagttaccagctgcagacccaaggcgtgtttttgttggggatgtagtggtcttgaaggaccctgataacccagataattatttggtgagaagattggctgccatagaagggtatgaaatgttgtctacggatgagaaagatgatccttttgtccttgaaaaagatgaatgctgggttttggctgataatgaaactttgaaggcaaaggaagccaatgatagtcgaaagtttggtcctgtttccatgacggacatagttggtagagtcatatattgcctacgaacagctgttgatcatggccctgttcagaatagtcattttagcatgagaaaggattcgcctgtcctggaagttgaattggatgtcgatgagatggcaaaaaaccacaaatcctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

205

Amino Acids

23.35

Weight (kDa)

5.77

Isoelectric Point (pI)

34.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 347
AclWI GGATC 1 cut(s) 359
AcsI RAATTY 1 cut(s) 127
AfiI CCNNNNNNNGG 2 cut(s) 191, 330
AgsI TTSAA 4 cut(s) 277, 380, 421, 578
AjnI CCWGG 2 cut(s) 17, 567
AluBI AGCT 4 cut(s) 43, 66, 233, 509
AluI AGCT 4 cut(s) 43, 66, 233, 509
AlwI GGATC 1 cut(s) 359
AoxI GGCC 2 cut(s) 180, 520
ApeKI GCWGC 2 cut(s) 233, 320
ApoI RAATTY 1 cut(s) 127
ArsI GACNNNNNNTTYG 2 cut(s) 439, 471
Asp700I GAANNNNTTC 1 cut(s) 556
AspS9I GGNCC 4 cut(s) 181, 280, 455, 521
AsuHPI GGTGA 2 cut(s) 122, 319
AvaII GGWCC 2 cut(s) 280, 455
BbvI GCAGC 2 cut(s) 220, 307
BccI CCATC 2 cut(s) 172, 589
BcgI CGANNNNNNTGC 2 cut(s) 35, 69
BciT130I CCWGG 2 cut(s) 19, 569
BclI TGATCA 1 cut(s) 514
BfaI CTAG 1 cut(s) 186
BfmI CTRYAG 1 cut(s) 234
BisI GCNGC 2 cut(s) 234, 321
BlsI GCNGC 2 cut(s) 235, 322
Bme1390I CCNGG 2 cut(s) 19, 569
Bme18I GGWCC 2 cut(s) 280, 455
BmgT120I GGNCC 4 cut(s) 181, 280, 455, 521
BmiI GGNNCC 3 cut(s) 23, 183, 282
BmrFI CCNGG 2 cut(s) 19, 569
BmsI GCATC 1 cut(s) 103
BsaJI CCNNGG 1 cut(s) 242
Bsc4I CCNNNNNNNGG 2 cut(s) 191, 330
BseBI CCWGG 2 cut(s) 19, 569
BseDI CCNNGG 1 cut(s) 242
BseGI GGATG 3 cut(s) 268, 358, 589
BseLI CCNNNNNNNGG 2 cut(s) 191, 330
BseXI GCAGC 2 cut(s) 220, 307
BseYI CCCAGC 1 cut(s) 393
BshFI GGCC 2 cut(s) 182, 522
BslI CCNNNNNNNGG 2 cut(s) 191, 330
BsmI GAATGC 1 cut(s) 395
BsnI GGCC 2 cut(s) 182, 522
Bsp143I GATC 2 cut(s) 364, 514
BspANI GGCC 2 cut(s) 182, 522
BspLI GGNNCC 3 cut(s) 23, 183, 282
BspMAI CTGCAG 1 cut(s) 238
BspPI GGATC 1 cut(s) 359
BssECI CCNNGG 1 cut(s) 242
BssMI GATC 2 cut(s) 364, 514
BssT1I CCWWGG 1 cut(s) 242
Bst2UI CCWGG 2 cut(s) 19, 569
BstENI CCTNNNNNAGG 1 cut(s) 189
BstF5I GGATG 3 cut(s) 268, 358, 589
BstKTI GATC 2 cut(s) 367, 517
BstMBI GATC 2 cut(s) 364, 514
BstMWI GCNNNNNNNGC 2 cut(s) 179, 431
BstNI CCWGG 2 cut(s) 19, 569
BstNSI RCATGY 1 cut(s) 157
BstSCI CCNGG 2 cut(s) 17, 567
BstSFI CTRYAG 1 cut(s) 234
BstV1I GCAGC 2 cut(s) 220, 307
BsuRI GGCC 2 cut(s) 182, 522
BtsCI GGATG 3 cut(s) 268, 358, 589
Cfr13I GGNCC 4 cut(s) 181, 280, 455, 521
CsiI ACCWGGT 1 cut(s) 17
CviAII CATG 4 cut(s) 154, 466, 518, 547
DpnI GATC 2 cut(s) 366, 516
DpnII GATC 2 cut(s) 364, 514
Eco130I CCWWGG 1 cut(s) 242
Eco47I GGWCC 2 cut(s) 280, 455
EcoNI CCTNNNNNAGG 1 cut(s) 189
EcoO109I RGGNCCY 1 cut(s) 280
EcoRII CCWGG 2 cut(s) 17, 567
EcoT14I CCWWGG 1 cut(s) 242
EcoT22I ATGCAT 1 cut(s) 159
ErhI CCWWGG 1 cut(s) 242
FaeI CATG 4 cut(s) 157, 469, 521, 550
FatI CATG 4 cut(s) 153, 465, 517, 546
FbaI TGATCA 1 cut(s) 514
FblI GTMKAC 1 cut(s) 347
Fnu4HI GCNGC 2 cut(s) 234, 321
FokI GGATG 3 cut(s) 275, 365, 596
Fsp4HI GCNGC 2 cut(s) 234, 321
FspBI CTAG 1 cut(s) 186
GluI GCNGC 2 cut(s) 234, 321
GsaI CCCAGC 1 cut(s) 397
HaeIII GGCC 2 cut(s) 182, 522
Hin1II CATG 4 cut(s) 157, 469, 521, 550
HincII GTYRAC 1 cut(s) 147
HindII GTYRAC 1 cut(s) 147
HinfI GANTC 2 cut(s) 486, 557
HphI GGTGA 2 cut(s) 122, 319
Hpy166II GTNNAC 2 cut(s) 147, 348
Hpy188I TCNGA 2 cut(s) 26, 531
Hpy188III TCNNGA 2 cut(s) 220, 274
Hpy8I GTNNAC 2 cut(s) 147, 348
HpyAV CCTTC 3 cut(s) 271, 323, 415
HpyCH4V TGCA 2 cut(s) 157, 236
HpyF10VI GCNNNNNNNGC 2 cut(s) 179, 431
Hsp92II CATG 4 cut(s) 157, 469, 521, 550
Ksp22I TGATCA 1 cut(s) 514
Kzo9I GATC 2 cut(s) 364, 514
LmnI GCTCC 2 cut(s) 170, 196
Lsp1109I GCAGC 2 cut(s) 220, 307
LweI GCATC 1 cut(s) 103
MabI ACCWGGT 1 cut(s) 17
MaeI CTAG 1 cut(s) 186
MaeIII GTNAC 1 cut(s) 225
MalI GATC 2 cut(s) 366, 516
MboI GATC 2 cut(s) 364, 514
MboII GAAGA 2 cut(s) 82, 324
MluCI AATT 3 cut(s) 127, 298, 578
MlyI GAGTC 1 cut(s) 495
MnlI CCTC 1 cut(s) 77
Mph1103I ATGCAT 1 cut(s) 159
MroXI GAANNNNTTC 1 cut(s) 556
MspA1I CMGCKG 3 cut(s) 66, 233, 509
MspR9I CCNGG 2 cut(s) 19, 569
Mva1269I GAATGC 1 cut(s) 395
MvaI CCWGG 2 cut(s) 19, 569
MwoI GCNNNNNNNGC 2 cut(s) 179, 431
NdeII GATC 2 cut(s) 364, 514
NlaIII CATG 4 cut(s) 157, 469, 521, 550
NlaIV GGNNCC 3 cut(s) 23, 183, 282
NsiI ATGCAT 1 cut(s) 159
NspI RCATGY 1 cut(s) 157
PctI GAATGC 1 cut(s) 395
PdmI GAANNNNTTC 1 cut(s) 556
PfeI GAWTC 1 cut(s) 557
PfoI TCCNGGA 1 cut(s) 567
PkrI GCNGC 2 cut(s) 235, 322
PleI GAGTC 1 cut(s) 494
PpsI GAGTC 1 cut(s) 494
PpuMI RGGWCCY 1 cut(s) 280
Psp5II RGGWCCY 1 cut(s) 280
Psp6I CCWGG 2 cut(s) 17, 567
PspFI CCCAGC 1 cut(s) 393
PspGI CCWGG 2 cut(s) 17, 567
PspN4I GGNNCC 3 cut(s) 23, 183, 282
PspPI GGNCC 4 cut(s) 181, 280, 455, 521
PspPPI RGGWCCY 1 cut(s) 280
PstI CTGCAG 1 cut(s) 238
PvuII CAGCTG 3 cut(s) 66, 233, 509
SatI GCNGC 2 cut(s) 234, 321
Sau3AI GATC 2 cut(s) 364, 514
Sau96I GGNCC 4 cut(s) 181, 280, 455, 521
SchI GAGTC 1 cut(s) 495
ScrFI CCNGG 2 cut(s) 19, 569
SetI ASST 6 cut(s) 20, 45, 68, 88, 235, 511
SexAI ACCWGGT 1 cut(s) 17
SfaNI GCATC 1 cut(s) 103
SfcI CTRYAG 1 cut(s) 234
SinI GGWCC 2 cut(s) 280, 455
Sse9I AATT 3 cut(s) 127, 298, 578
SspI AATATT 1 cut(s) 50
SspMI CTAG 1 cut(s) 186
StyD4I CCNGG 2 cut(s) 17, 567
StyI CCWWGG 1 cut(s) 242
TaqI TCGA 3 cut(s) 45, 445, 588
TasI AATT 3 cut(s) 127, 298, 578
TfiI GAWTC 1 cut(s) 557
TseI GCWGC 2 cut(s) 233, 320
TspDTI ATGAA 3 cut(s) 351, 402, 426
TspGWI ACGGA 2 cut(s) 365, 485
VpaK11BI GGWCC 2 cut(s) 280, 455
XagI CCTNNNNNAGG 1 cut(s) 189
XapI RAATTY 1 cut(s) 127
XceI RCATGY 1 cut(s) 157
XmiI GTMKAC 1 cut(s) 347
XmnI GAANNNNTTC 1 cut(s) 556
XspI CTAG 1 cut(s) 186
Zsp2I ATGCAT 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.