Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0008010

Physical Location & Seq

Genomic Coordinates Reverse (-)

20221445 .. 20225047

Gene Structure 3603 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00180900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 393 bp

ATGGTTTCCCTATCCACCTGGTTCCGATACATAGCCCACAAGCTCGAATATTCTGCCACTATCAGCTGGAAGAACTATAAAAGAGGTCAAATCACAGACAGAGAACTTGGTGATGCTGTTTGGAAAAATTTGTTTCAGGGAAAGTTGACATACATGCATTGGAATAAAGGAGCAGAGATGGCCCCTAGTATAGGGGGGGAGCAAGGAGGAACCCTCCTTGTCAGGAAGTTACCAGCTGCAGACCCAAGGCGTGTTTTTGTTGGGGATGTAGTGGTCTTGAAGGACCCTGATAACCCAGATAACTTTTTGGTGAGAAGATTGGCTGCCATAGAAGGGTATGAAATGTTGTCTACGGATGAGAAAGATGATCCTTTTGTCCTTGAAAAAAGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03060 map03060

Pfam Domains

Protein Families

Peptidase_S24

Protein Analysis

130

Amino Acids

14.89

Weight (kDa)

7.94

Isoelectric Point (pI)

35.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008010)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G06200 AT1G06200 AT2G31140
fragaria_vesca	FvH4_2g21360 FvH4_2g21360 FvH4_2g21360
malus_domestica	MD05G1196300.v1.1 MD10G1183600.v1.1
prunus_persica	Prupe.8G222700_v2.0.a1 Prupe.8G222700_v2.0.a1
pyrus_communis	pycom05g18330 pycom10g15860
rosa_chinensis	RchiOBHm_Chr6g0287951
rosa_laevigata	RLG00000012453
rosa_multiflora	Rmu_sc0000042.1_g000001
rosa_roxburghii	Rroxscaffold_7G00180640 Rroxscaffold_7G00180900
rosa_rugosa	Rorug06G0193600
rosa_samantha	Rh6AG302900 Rh6BG309100 Rh6CG300600 Rh6CG316800 Rh6DG301600
rosa_wichuraiana	Rw6G026190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	350
AclWI	GGATC	1 cut(s)	362
AcsI	RAATTY	1 cut(s)	127
AfiI	CCNNNNNNNGG	2 cut(s)	191, 333
AgsI	TTSAA	2 cut(s)	280, 383
AjnI	CCWGG	1 cut(s)	17
AluBI	AGCT	3 cut(s)	43, 66, 236
AluI	AGCT	3 cut(s)	43, 66, 236
AlwI	GGATC	1 cut(s)	362
AoxI	GGCC	1 cut(s)	180
ApeKI	GCWGC	2 cut(s)	236, 323
ApoI	RAATTY	1 cut(s)	127
AspS9I	GGNCC	2 cut(s)	181, 283
AsuHPI	GGTGA	2 cut(s)	122, 322
AvaII	GGWCC	1 cut(s)	283
BbvI	GCAGC	2 cut(s)	223, 310
BccI	CCATC	1 cut(s)	172
BcgI	CGANNNNNNTGC	2 cut(s)	35, 69
BciT130I	CCWGG	1 cut(s)	19
BfaI	CTAG	1 cut(s)	186
BfmI	CTRYAG	1 cut(s)	237
BisI	GCNGC	2 cut(s)	237, 324
BlsI	GCNGC	2 cut(s)	238, 325
Bme1390I	CCNGG	1 cut(s)	19
Bme18I	GGWCC	1 cut(s)	283
BmgT120I	GGNCC	2 cut(s)	181, 283
BmiI	GGNNCC	4 cut(s)	23, 183, 211, 285
BmrFI	CCNGG	1 cut(s)	19
BmsI	GCATC	1 cut(s)	103
BplI	GAGNNNNNCTC	2 cut(s)	198, 230
BsaJI	CCNNGG	1 cut(s)	245
Bsc4I	CCNNNNNNNGG	2 cut(s)	191, 333
BseBI	CCWGG	1 cut(s)	19
BseDI	CCNNGG	1 cut(s)	245
BseGI	GGATG	2 cut(s)	271, 361
BseLI	CCNNNNNNNGG	2 cut(s)	191, 333
BseXI	GCAGC	2 cut(s)	223, 310
BshFI	GGCC	1 cut(s)	182
BslI	CCNNNNNNNGG	2 cut(s)	191, 333
BsnI	GGCC	1 cut(s)	182
Bsp143I	GATC	1 cut(s)	367
BspANI	GGCC	1 cut(s)	182
BspLI	GGNNCC	4 cut(s)	23, 183, 211, 285
BspMAI	CTGCAG	1 cut(s)	241
BspPI	GGATC	1 cut(s)	362
BssECI	CCNNGG	1 cut(s)	245
BssMI	GATC	1 cut(s)	367
BssT1I	CCWWGG	1 cut(s)	245
Bst2UI	CCWGG	1 cut(s)	19
BstENI	CCTNNNNNAGG	1 cut(s)	189
BstF5I	GGATG	2 cut(s)	271, 361
BstKTI	GATC	1 cut(s)	370
BstMBI	GATC	1 cut(s)	367
BstMWI	GCNNNNNNNGC	1 cut(s)	179
BstNI	CCWGG	1 cut(s)	19
BstNSI	RCATGY	1 cut(s)	157
BstSCI	CCNGG	1 cut(s)	17
BstSFI	CTRYAG	1 cut(s)	237
BstV1I	GCAGC	2 cut(s)	223, 310
BsuRI	GGCC	1 cut(s)	182
BtsCI	GGATG	2 cut(s)	271, 361
Cfr13I	GGNCC	2 cut(s)	181, 283
CsiI	ACCWGGT	1 cut(s)	17
CviAII	CATG	1 cut(s)	154
CviJI	RGCY	6 cut(s)	35, 43, 66, 182, 236, 323
CviKI_1	RGCY	6 cut(s)	35, 43, 66, 182, 236, 323
DpnI	GATC	1 cut(s)	369
DpnII	GATC	1 cut(s)	367
Eco130I	CCWWGG	1 cut(s)	245
Eco47I	GGWCC	1 cut(s)	283
EcoNI	CCTNNNNNAGG	1 cut(s)	189
EcoO109I	RGGNCCY	1 cut(s)	283
EcoRII	CCWGG	1 cut(s)	17
EcoT14I	CCWWGG	1 cut(s)	245
EcoT22I	ATGCAT	1 cut(s)	159
ErhI	CCWWGG	1 cut(s)	245
FaeI	CATG	1 cut(s)	157
FaiI	YATR	7 cut(s)	32, 78, 151, 155, 191, 329, 339
FatI	CATG	1 cut(s)	153
FblI	GTMKAC	1 cut(s)	350
Fnu4HI	GCNGC	2 cut(s)	237, 324
FokI	GGATG	2 cut(s)	278, 368
Fsp4HI	GCNGC	2 cut(s)	237, 324
FspBI	CTAG	1 cut(s)	186
GluI	GCNGC	2 cut(s)	237, 324
HaeIII	GGCC	1 cut(s)	182
Hin1II	CATG	1 cut(s)	157
HincII	GTYRAC	1 cut(s)	147
HindII	GTYRAC	1 cut(s)	147
HphI	GGTGA	2 cut(s)	122, 322
Hpy166II	GTNNAC	2 cut(s)	147, 351
Hpy188I	TCNGA	1 cut(s)	26
Hpy188III	TCNNGA	2 cut(s)	223, 277
Hpy8I	GTNNAC	2 cut(s)	147, 351
HpyAV	CCTTC	2 cut(s)	274, 326
HpyCH4V	TGCA	2 cut(s)	157, 239
HpyF10VI	GCNNNNNNNGC	1 cut(s)	179
Hsp92II	CATG	1 cut(s)	157
Kzo9I	GATC	1 cut(s)	367
LmnI	GCTCC	2 cut(s)	170, 199
LpnPI	CCDG	8 cut(s)	4, 31, 52, 122, 208, 246, 300, 309
Lsp1109I	GCAGC	2 cut(s)	223, 310
LweI	GCATC	1 cut(s)	103
MabI	ACCWGGT	1 cut(s)	17
MaeI	CTAG	1 cut(s)	186
MaeIII	GTNAC	1 cut(s)	228
MalI	GATC	1 cut(s)	369
MboI	GATC	1 cut(s)	367
MboII	GAAGA	2 cut(s)	82, 327
MluCI	AATT	1 cut(s)	127
MnlI	CCTC	3 cut(s)	77, 200, 224
Mph1103I	ATGCAT	1 cut(s)	159
MspA1I	CMGCKG	2 cut(s)	66, 236
MspR9I	CCNGG	1 cut(s)	19
MvaI	CCWGG	1 cut(s)	19
MwoI	GCNNNNNNNGC	1 cut(s)	179
NdeII	GATC	1 cut(s)	367
NlaIII	CATG	1 cut(s)	157
NlaIV	GGNNCC	4 cut(s)	23, 183, 211, 285
NsiI	ATGCAT	1 cut(s)	159
NspI	RCATGY	1 cut(s)	157
PkrI	GCNGC	2 cut(s)	238, 325
PpuMI	RGGWCCY	1 cut(s)	283
Psp5II	RGGWCCY	1 cut(s)	283
Psp6I	CCWGG	1 cut(s)	17
PspGI	CCWGG	1 cut(s)	17
PspN4I	GGNNCC	4 cut(s)	23, 183, 211, 285
PspPI	GGNCC	2 cut(s)	181, 283
PspPPI	RGGWCCY	1 cut(s)	283
PstI	CTGCAG	1 cut(s)	241
PvuII	CAGCTG	2 cut(s)	66, 236
SatI	GCNGC	2 cut(s)	237, 324
Sau3AI	GATC	1 cut(s)	367
Sau96I	GGNCC	2 cut(s)	181, 283
ScrFI	CCNGG	1 cut(s)	19
SetI	ASST	5 cut(s)	20, 45, 68, 88, 238
SexAI	ACCWGGT	1 cut(s)	17
SfaNI	GCATC	1 cut(s)	103
SfcI	CTRYAG	1 cut(s)	237
SinI	GGWCC	1 cut(s)	283
Sse9I	AATT	1 cut(s)	127
SspI	AATATT	1 cut(s)	50
SspMI	CTAG	1 cut(s)	186
StyD4I	CCNGG	1 cut(s)	17
StyI	CCWWGG	1 cut(s)	245
TaqI	TCGA	1 cut(s)	45
TasI	AATT	1 cut(s)	127
TseI	GCWGC	2 cut(s)	236, 323
TspDTI	ATGAA	1 cut(s)	354
TspGWI	ACGGA	1 cut(s)	368
VpaK11BI	GGWCC	1 cut(s)	283
XagI	CCTNNNNNAGG	1 cut(s)	189
XapI	RAATTY	1 cut(s)	127
XceI	RCATGY	1 cut(s)	157
XmiI	GTMKAC	1 cut(s)	350
XspI	CTAG	1 cut(s)	186
Zsp2I	ATGCAT	1 cut(s)	159

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.