Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000051.1

Orthogroup ID

OG0009013

Physical Location & Seq

Genomic Coordinates Reverse (-)

100347 .. 107433

Gene Structure 7087 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1098 bp

atgaggctaaaggtactgacccttagagtttctcaaccaaatccggattcgcagcctcctttccccggttgcttcgccgccagattcgtagcctcctttccccggttgcttcgccagattcgcagcctcccttcaccggttgcttcgtcagattcgcagcctcctttcaccggttgcttcgccggattcgcagcctcccttcaccggttgcttcgccagattcgcagcctcctttccccggttgcttcgccggattcgcagcctcccttcaccggcttcgcaacctcgcctcccttcgctggatttgcagcctcccttcgccggttgcttcgtcgcctcgatccgccagctgcttcgtctcttaccttcatcggagccctatatcgatttagggaggatttggattttgggatggtttcgatttggaaccgatctgattttggtagaaattggttattaaccactaatgaaattgacaaagcagtgcatcagatgattattgatgctggtgcttatccctcacctcttggatatgggggatttccaaagagtgtgtgcacatctgttaacgagtgcatgtgccatggaatacctgattctcgtcaattacaggacggagacatcataaacatagatgttactgtctacctaaacggatatcatggagacacatcaaagacatttctttgtggggaggtcagtgatagtatgcaacgcctagtgaaggtaacggaagagtgcttggaaagaggcatagcagtttgcaaggatggtgctagcttcaagaaaattggaaagagaattagtgaacatgctgaaaaatttggttatggcgtggtagaacgttttgttgggcatggtgtgggtaccgtatttcattctgaaccattgatattacatcaccgcaatgaccagtctggtagcatggttgaaggtcaaacatttactattgaacccatccttactatgggaagcattgagtgcgtaacatggccagacaattggacaactctaaccgccgatggtagccccgctgcgcagtttgagcataccattctgattactagaactggtgctgaaattttaaccacatgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006464 GO:0006807 GO:0008150 GO:0008152 GO:0009507 GO:0009536 GO:0009987 GO:0019538 GO:0031365 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0071704 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_M24

Protein Analysis

365

Amino Acids

40.02

Weight (kDa)

6.79

Isoelectric Point (pI)

56.78

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Peptidase_M24	PF00557	154 - 355	1.5e-45	Metallopeptidase family M24

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009013)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G13270 AT1G13270
fragaria_vesca	FvH4_4g28020
malus_domestica	MD13G1046000.v1.1 MD16G1047600.v1.1
prunus_persica	Prupe.1G306000_v2.0.a1 Prupe.1G306000_v2.0.a1 Prupe.1G306000_v2.0.a1 Prupe.1G306000_v2.0.a1
pyrus_communis	pycom13g04040 pycom16g04160
rosa_chinensis	RchiOBHm_Chr4g0435761
rosa_laevigata	RLG00000006561
rosa_multiflora	Rmu_co8005306.1_g000001 Rmu_sc0000051.1_g000022 Rmu_sc0036818.1_g000001
rosa_rugosa	Rorug04G0289400
rosa_samantha	Rh4AG343700 Rh4BG352400 Rh4CG366900 Rh4DG346300
rosa_wichuraiana	Rw4G030010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	1038
Acc65I	GGTACC	1 cut(s)	866
AccB1I	GGYRCC	1 cut(s)	866
AccI	GTMKAC	1 cut(s)	645
AccIII	TCCGGA	1 cut(s)	43
AciI	CCGC	5 cut(s)	78, 344, 904, 1017, 1032
AclI	AACGTT	1 cut(s)	844
AclWI	GGATC	1 cut(s)	335
AcoI	YGGCCR	1 cut(s)	992
AcsI	RAATTY	2 cut(s)	821, 1080
AfaI	GTAC	2 cut(s)	15, 868
AflIII	ACRYGT	1 cut(s)	1091
AgeI	ACCGGT	3 cut(s)	136, 170, 204
AgsI	TTSAA	3 cut(s)	784, 932, 953
AjuI	GAANNNNNNNTTGG	4 cut(s)	31, 63, 834, 866
AluBI	AGCT	2 cut(s)	350, 780
AluI	AGCT	2 cut(s)	350, 780
Alw21I	GWGCWC	1 cut(s)	560
Alw26I	GTCTC	3 cut(s)	363, 612, 660
Alw44I	GTGCAC	1 cut(s)	556
AlwI	GGATC	1 cut(s)	335
Aor13HI	TCCGGA	1 cut(s)	43
AoxI	GGCC	1 cut(s)	992
ApaLI	GTGCAC	1 cut(s)	556
ApeKI	GCWGC	9 cut(s)	52, 123, 157, 191, 225, 259, 308, 350, 1034
ApoI	RAATTY	2 cut(s)	821, 1080
AsiGI	ACCGGT	3 cut(s)	136, 170, 204
Asp718I	GGTACC	1 cut(s)	866
AspLEI	GCGC	1 cut(s)	1039
AsuC2I	CCSGG	3 cut(s)	66, 103, 239
AsuHPI	GGTGA	6 cut(s)	126, 160, 194, 262, 513, 893
AsuNHI	GCTAGC	1 cut(s)	776
BaeGI	GKGCMC	1 cut(s)	560
BalI	TGGCCA	1 cut(s)	994
BanI	GGYRCC	1 cut(s)	866
BanII	GRGCYC	1 cut(s)	379
Bbv12I	GWGCWC	1 cut(s)	560
BbvI	GCAGC	9 cut(s)	64, 135, 169, 203, 237, 271, 320, 337, 1021
BccI	CCATC	4 cut(s)	406, 764, 965, 1016
BcnI	CCSGG	3 cut(s)	66, 103, 239
BcoDI	GTCTC	3 cut(s)	363, 612, 660
BfaI	CTAG	3 cut(s)	719, 777, 1065
Bme1390I	CCNGG	3 cut(s)	66, 103, 239
BmiI	GGNNCC	3 cut(s)	376, 428, 868
BmrFI	CCNGG	3 cut(s)	66, 103, 239
BmsI	GCATC	2 cut(s)	493, 496
BmtI	GCTAGC	1 cut(s)	780
BpuMI	CCSGG	3 cut(s)	66, 103, 239
Bsa29I	ATCGAT	1 cut(s)	385
BsaJI	CCNNGG	4 cut(s)	64, 101, 237, 583
BsaWI	WCCGGW	4 cut(s)	43, 136, 170, 204
BsaXI	ACNNNNNCTCC	2 cut(s)	274, 304
Bse118I	RCCGGY	5 cut(s)	136, 170, 204, 272, 321
Bse1I	ACTGG	2 cut(s)	913, 1075
Bse3DI	GCAATG	1 cut(s)	913
BseAI	TCCGGA	1 cut(s)	43
BseCI	ATCGAT	1 cut(s)	385
BseDI	CCNNGG	4 cut(s)	64, 101, 237, 583
BseGI	GGATG	3 cut(s)	417, 775, 957
BseMI	GCAATG	1 cut(s)	913
BseNI	ACTGG	2 cut(s)	913, 1075
BseSI	GKGCMC	1 cut(s)	560
BseXI	GCAGC	9 cut(s)	64, 135, 169, 203, 237, 271, 320, 337, 1021
BshFI	GGCC	1 cut(s)	994
BshNI	GGYRCC	1 cut(s)	866
BshTI	ACCGGT	3 cut(s)	136, 170, 204
BshVI	ATCGAT	1 cut(s)	385
BsiHKAI	GWGCWC	1 cut(s)	560
BsmAI	GTCTC	3 cut(s)	363, 612, 660
BsmBI	CGTCTC	1 cut(s)	363
BsnI	GGCC	1 cut(s)	994
Bsp1286I	GDGCHC	2 cut(s)	379, 560
Bsp13I	TCCGGA	1 cut(s)	43
Bsp143I	GATC	2 cut(s)	340, 431
Bsp19I	CCATGG	1 cut(s)	583
BspACI	CCGC	5 cut(s)	78, 344, 904, 1017, 1032
BspANI	GGCC	1 cut(s)	994
BspDI	ATCGAT	1 cut(s)	385
BspEI	TCCGGA	1 cut(s)	43
BspLI	GGNNCC	3 cut(s)	376, 428, 868
BspOI	GCTAGC	1 cut(s)	780
BspPI	GGATC	1 cut(s)	335
BspT107I	GGYRCC	1 cut(s)	866
BsrDI	GCAATG	1 cut(s)	913
BsrFI	RCCGGY	5 cut(s)	136, 170, 204, 272, 321
BsrI	ACTGG	2 cut(s)	913, 1075
BssAI	RCCGGY	5 cut(s)	136, 170, 204, 272, 321
BssECI	CCNNGG	4 cut(s)	64, 101, 237, 583
BssMI	GATC	2 cut(s)	340, 431
BssT1I	CCWWGG	1 cut(s)	583
Bst4CI	ACNGT	2 cut(s)	643, 871
Bst6I	CTCTTC	1 cut(s)	729
BstAPI	GCANNNNNTGC	1 cut(s)	981
BstC8I	GCNNGC	2 cut(s)	348, 778
BstDEI	CTNAG	1 cut(s)	23
BstDSI	CCRYGG	1 cut(s)	583
BstENI	CCTNNNNNAGG	1 cut(s)	722
BstF5I	GGATG	3 cut(s)	417, 775, 957
BstHHI	GCGC	1 cut(s)	1039
BstKTI	GATC	2 cut(s)	343, 434
BstMAI	GTCTC	3 cut(s)	363, 612, 660
BstMBI	GATC	2 cut(s)	340, 431
BstMWI	GCNNNNNNNGC	7 cut(s)	120, 188, 222, 256, 305, 981, 1045
BstNSI	RCATGY	3 cut(s)	580, 815, 1095
BstSCI	CCNGG	3 cut(s)	64, 101, 237
BstSLI	GKGCMC	1 cut(s)	560
BstV1I	GCAGC	9 cut(s)	64, 135, 169, 203, 237, 271, 320, 337, 1021
BstXI	CCANNNNNNTGG	1 cut(s)	1002
Bsu15I	ATCGAT	1 cut(s)	385
BsuRI	GGCC	1 cut(s)	994
BsuTUI	ATCGAT	1 cut(s)	385
BtgI	CCRYGG	1 cut(s)	583
BtsCI	GGATG	3 cut(s)	417, 775, 957
BtsI	GCAGTG	1 cut(s)	489
BtsIMutI	CAGTG	2 cut(s)	489, 706
Cac8I	GCNNGC	2 cut(s)	348, 778
CfoI	GCGC	1 cut(s)	1039
Cfr10I	RCCGGY	5 cut(s)	136, 170, 204, 272, 321
ClaI	ATCGAT	1 cut(s)	385
Csp6I	GTAC	2 cut(s)	14, 867
CspAI	ACCGGT	3 cut(s)	136, 170, 204
CviAII	CATG	8 cut(s)	577, 584, 662, 812, 857, 925, 990, 1092
CviQI	GTAC	2 cut(s)	14, 867
DdeI	CTNAG	1 cut(s)	23
DpnI	GATC	2 cut(s)	342, 433
DpnII	GATC	2 cut(s)	340, 431
EaeI	YGGCCR	1 cut(s)	992
Eam1104I	CTCTTC	1 cut(s)	729
EarI	CTCTTC	1 cut(s)	729
EciI	GGCGGA	1 cut(s)	333
Eco130I	CCWWGG	1 cut(s)	583
Eco24I	GRGCYC	1 cut(s)	379
Eco32I	GATATC	1 cut(s)	659
EcoNI	CCTNNNNNAGG	1 cut(s)	722
EcoRV	GATATC	1 cut(s)	659
EcoT14I	CCWWGG	1 cut(s)	583
EcoT38I	GRGCYC	1 cut(s)	379
ErhI	CCWWGG	1 cut(s)	583
Esp3I	CGTCTC	1 cut(s)	363
FaeI	CATG	8 cut(s)	580, 587, 665, 815, 860, 928, 993, 1095
FatI	CATG	8 cut(s)	576, 583, 661, 811, 856, 924, 989, 1091
FauI	CCCGC	1 cut(s)	1039
FblI	GTMKAC	1 cut(s)	645
FokI	GGATG	3 cut(s)	424, 782, 944
FriOI	GRGCYC	1 cut(s)	379
FspBI	CTAG	3 cut(s)	719, 777, 1065
FspI	TGCGCA	1 cut(s)	1038
GlaI	GCGC	1 cut(s)	1038
HaeIII	GGCC	1 cut(s)	994
HhaI	GCGC	1 cut(s)	1039
Hin1II	CATG	8 cut(s)	580, 587, 665, 815, 860, 928, 993, 1095
Hin6I	GCGC	1 cut(s)	1037
HinP1I	GCGC	1 cut(s)	1037
HincII	GTYRAC	1 cut(s)	568
HindII	GTYRAC	1 cut(s)	568
HinfI	GANTC	8 cut(s)	47, 84, 118, 152, 186, 220, 254, 596
HpaI	GTTAAC	1 cut(s)	568
HphI	GGTGA	6 cut(s)	126, 160, 194, 262, 513, 893
Hpy166II	GTNNAC	4 cut(s)	558, 568, 646, 809
Hpy188I	TCNGA	6 cut(s)	151, 374, 436, 492, 883, 1059
Hpy188III	TCNNGA	2 cut(s)	44, 784
Hpy8I	GTNNAC	4 cut(s)	558, 568, 646, 809
Hpy99I	CGWCG	1 cut(s)	336
HpyAV	CCTTC	8 cut(s)	141, 209, 277, 304, 326, 376, 718, 926
HpyCH4III	ACNGT	2 cut(s)	643, 871
HpyCH4IV	ACGT	1 cut(s)	844
HpyCH4V	TGCA	6 cut(s)	308, 487, 558, 576, 712, 765
HpyF10VI	GCNNNNNNNGC	7 cut(s)	120, 188, 222, 256, 305, 981, 1045
HpyF3I	CTNAG	1 cut(s)	23
HpySE526I	ACGT	1 cut(s)	844
Hsp92II	CATG	8 cut(s)	580, 587, 665, 815, 860, 928, 993, 1095
HspAI	GCGC	1 cut(s)	1037
Kpn2I	TCCGGA	1 cut(s)	43
KpnI	GGTACC	1 cut(s)	870
KspAI	GTTAAC	1 cut(s)	568
Kzo9I	GATC	2 cut(s)	340, 431
LmnI	GCTCC	1 cut(s)	374
Lsp1109I	GCAGC	9 cut(s)	64, 135, 169, 203, 237, 271, 320, 337, 1021
LweI	GCATC	2 cut(s)	493, 496
MaeI	CTAG	3 cut(s)	719, 777, 1065
MaeII	ACGT	1 cut(s)	844
MaeIII	GTNAC	3 cut(s)	637, 727, 985
MalI	GATC	2 cut(s)	342, 433
MboI	GATC	2 cut(s)	340, 431
MboII	GAAGA	1 cut(s)	746
MfeI	CAATTG	1 cut(s)	1000
MhlI	GDGCHC	2 cut(s)	379, 560
MlsI	TGGCCA	1 cut(s)	994
MluCI	AATT	8 cut(s)	448, 471, 605, 789, 801, 821, 1000, 1080
MluNI	TGGCCA	1 cut(s)	994
Mox20I	TGGCCA	1 cut(s)	994
MroI	TCCGGA	1 cut(s)	43
MscI	TGGCCA	1 cut(s)	994
MseI	TTAA	3 cut(s)	458, 567, 1085
MslI	CAYNNNNRTG	1 cut(s)	906
Msp20I	TGGCCA	1 cut(s)	994
MspA1I	CMGCKG	2 cut(s)	350, 1034
MspR9I	CCNGG	3 cut(s)	66, 103, 239
MunI	CAATTG	1 cut(s)	1000
MwoI	GCNNNNNNNGC	7 cut(s)	120, 188, 222, 256, 305, 981, 1045
NciI	CCSGG	3 cut(s)	66, 103, 239
NcoI	CCATGG	1 cut(s)	583
NdeII	GATC	2 cut(s)	340, 431
NheI	GCTAGC	1 cut(s)	776
NlaIII	CATG	8 cut(s)	580, 587, 665, 815, 860, 928, 993, 1095
NlaIV	GGNNCC	3 cut(s)	376, 428, 868
NsbI	TGCGCA	1 cut(s)	1038
NspI	RCATGY	3 cut(s)	580, 815, 1095
PciI	ACATGT	1 cut(s)	1091
PfeI	GAWTC	8 cut(s)	47, 84, 118, 152, 186, 220, 254, 596
PinAI	ACCGGT	3 cut(s)	136, 170, 204
PscI	ACATGT	1 cut(s)	1091
Psp1406I	AACGTT	1 cut(s)	844
PspN4I	GGNNCC	3 cut(s)	376, 428, 868
PvuII	CAGCTG	1 cut(s)	350
RsaI	GTAC	2 cut(s)	15, 868
RsaNI	GTAC	2 cut(s)	14, 867
RseI	CAYNNNNRTG	1 cut(s)	906
SaqAI	TTAA	3 cut(s)	458, 567, 1085
Sau3AI	GATC	2 cut(s)	340, 431
ScrFI	CCNGG	3 cut(s)	66, 103, 239
SduI	GDGCHC	2 cut(s)	379, 560
SfaNI	GCATC	2 cut(s)	493, 496
SmiMI	CAYNNNNRTG	1 cut(s)	906
Sse9I	AATT	8 cut(s)	448, 471, 605, 789, 801, 821, 1000, 1080
SsiI	CCGC	5 cut(s)	78, 344, 904, 1017, 1032
SspMI	CTAG	3 cut(s)	719, 777, 1065
StyD4I	CCNGG	3 cut(s)	64, 101, 237
StyI	CCWWGG	1 cut(s)	583
TaaI	ACNGT	2 cut(s)	643, 871
TaiI	ACGT	1 cut(s)	847
TaqI	TCGA	3 cut(s)	339, 385, 419
TasI	AATT	8 cut(s)	448, 471, 605, 789, 801, 821, 1000, 1080
TauI	GCSGC	1 cut(s)	80
TfiI	GAWTC	8 cut(s)	47, 84, 118, 152, 186, 220, 254, 596
Tru1I	TTAA	3 cut(s)	458, 567, 1085
Tru9I	TTAA	3 cut(s)	458, 567, 1085
TscAI	CASTG	2 cut(s)	489, 706
TseI	GCWGC	9 cut(s)	52, 123, 157, 191, 225, 259, 308, 350, 1034
TspDTI	ATGAA	3 cut(s)	358, 483, 866
TspGWI	ACGGA	3 cut(s)	630, 669, 746
TspRI	CASTG	2 cut(s)	489, 706
VneI	GTGCAC	1 cut(s)	556
XagI	CCTNNNNNAGG	1 cut(s)	722
XapI	RAATTY	2 cut(s)	821, 1080
XceI	RCATGY	3 cut(s)	580, 815, 1095
XcmI	CCANNNNNNNNNTGG	1 cut(s)	964
XmiI	GTMKAC	1 cut(s)	645
XspI	CTAG	3 cut(s)	719, 777, 1065

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.