Rmu_sc0000078.1_g000042
WRKY Family

WRKY transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000078.1
Physical Location & Seq
Forward (+)
184684 .. 186000
1317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000078.1_g000042.1.cds

Sequence Viewer

Length: 945 bp
atggagaaggttgaatcagctaacaaagcagcagtagagagttgccatacagttcttaacagtctcttgtgcaaacccaaaaatgatattcagtctaaaagtttaggggtgcagactgaggaggctgtggttaagttcaagagagttgtgtctcttctgagtcatggaagaaggatcagaaagttgaagaagaagctcgattcatctttgcctcaaagcctcttcttggatggccctaattacagatcagacatttcaagcaaaaccctccaattactcccagctacttttcctcaaaacctacacacacaaaaccagaaagtgtttctaggaaacccagtgttggatatgagtaacaagcttcctctccaaattgccaaaccaaaaccattgcagcagttacatagacttcaagtccatccccaacagttcaccggcataaaccttgcatttaacaagcctagcaccacaccctccttgtcaaacgcagcgtcgttcatatcatgtttgagcatggatgctggtggtgtggctaactatggcagcaactccttcagactaatcaatggcagcgtgccacagtcgtctgatcagatctcgcaacaacaaaggaggagcagtggtgcagagcaaagcagcagtgtaaaatgtggcagtaatgataagtgtcctaattcaaggaagaggagactgagggtgagaagatctttcaaggttcctgcagtgagtcagaatgttgcaaacattcctggtgatgagtattcatggaggaaatatgggcagaagccaatcaagggctctccttatcctaggggatattataaatgtagcagcatgagaggctgcccagcaaggaaacatgtcgagcgatgcttggaagacccttcaatgctgatagtcacctatgagggcgagcacaagcattcacaatctgcccatcaatga

Protein Analysis

314

Amino Acids

34.93

Weight (kDa)

10.0

Isoelectric Point (pI)

61.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011183)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 822
AclWI GGATC 1 cut(s) 182
AcuI CTGAAG 1 cut(s) 538
AfiI CCNNNNNNNGG 3 cut(s) 226, 343, 794
AflIII ACRYGT 1 cut(s) 859
AgsI TTSAA 8 cut(s) 14, 139, 187, 258, 413, 678, 712, 888
AhdI GACNNNNNGTC 1 cut(s) 413
AjnI CCWGG 1 cut(s) 748
AluBI AGCT 4 cut(s) 20, 196, 284, 361
AluI AGCT 4 cut(s) 20, 196, 284, 361
Alw21I GWGCWC 1 cut(s) 918
Alw26I GTCTC 3 cut(s) 68, 156, 682
AlwI GGATC 1 cut(s) 182
AoxI GGCC 1 cut(s) 232
ApeKI GCWGC 8 cut(s) 29, 394, 488, 543, 570, 636, 831, 843
ArsI GACNNNNNNTTYG 2 cut(s) 476, 508
AspA2I CCTAGG 1 cut(s) 809
AspS9I GGNCC 1 cut(s) 233
AsuHPI GGTGA 4 cut(s) 424, 709, 764, 892
AvrII CCTAGG 1 cut(s) 809
BanII GRGCYC 1 cut(s) 800
BbsI GAAGAC 1 cut(s) 885
Bbv12I GWGCWC 1 cut(s) 918
BbvI GCAGC 8 cut(s) 41, 406, 500, 555, 582, 648, 830, 843
BccI CCATC 2 cut(s) 224, 426
BciT130I CCWGG 1 cut(s) 750
BclI TGATCA 1 cut(s) 589
BcoDI GTCTC 3 cut(s) 68, 156, 682
BfaI CTAG 3 cut(s) 329, 462, 810
BfmI CTRYAG 1 cut(s) 720
BglII AGATCT 2 cut(s) 594, 704
BisI GCNGC 8 cut(s) 30, 395, 489, 544, 571, 637, 832, 844
BlnI CCTAGG 1 cut(s) 809
BlsI GCNGC 8 cut(s) 31, 396, 490, 545, 572, 638, 833, 845
Bme1390I CCNGG 1 cut(s) 750
BmeRI GACNNNNNGTC 1 cut(s) 413
BmgT120I GGNCC 1 cut(s) 233
BmiI GGNNCC 1 cut(s) 717
BmrFI CCNGG 1 cut(s) 750
BmrI ACTGGG 1 cut(s) 332
BmsI GCATC 2 cut(s) 508, 860
BmuI ACTGGG 1 cut(s) 332
BpiI GAAGAC 1 cut(s) 885
BsaJI CCNNGG 1 cut(s) 809
BsaXI ACNNNNNCTCC 4 cut(s) 604, 607, 634, 637
Bsc4I CCNNNNNNNGG 3 cut(s) 226, 343, 794
Bse118I RCCGGY 1 cut(s) 434
Bse1I ACTGG 1 cut(s) 338
Bse3DI GCAATG 1 cut(s) 389
BseBI CCWGG 1 cut(s) 750
BseDI CCNNGG 1 cut(s) 809
BseGI GGATG 3 cut(s) 235, 418, 523
BseLI CCNNNNNNNGG 3 cut(s) 226, 343, 794
BseMI GCAATG 1 cut(s) 389
BseMII CTCAG 3 cut(s) 108, 149, 683
BseNI ACTGG 1 cut(s) 338
BseRI GAGGAG 3 cut(s) 134, 628, 700
BseXI GCAGC 8 cut(s) 41, 406, 500, 555, 582, 648, 830, 843
BseYI CCCAGC 2 cut(s) 280, 847
BsgI GTGCAG 2 cut(s) 131, 645
BshFI GGCC 1 cut(s) 234
BsiHKAI GWGCWC 1 cut(s) 918
BsiSI CCGG 1 cut(s) 435
BslI CCNNNNNNNGG 3 cut(s) 226, 343, 794
BsmAI GTCTC 3 cut(s) 68, 156, 682
BsmI GAATGC 1 cut(s) 922
BsnI GGCC 1 cut(s) 234
Bsp1286I GDGCHC 2 cut(s) 800, 918
Bsp143I GATC 5 cut(s) 174, 245, 589, 594, 704
BspANI GGCC 1 cut(s) 234
BspCNI CTCAG 3 cut(s) 109, 150, 684
BspLI GGNNCC 1 cut(s) 717
BspMAI CTGCAG 1 cut(s) 724
BspPI GGATC 1 cut(s) 182
BsrDI GCAATG 1 cut(s) 389
BsrFI RCCGGY 1 cut(s) 434
BsrI ACTGG 1 cut(s) 338
BssAI RCCGGY 1 cut(s) 434
BssECI CCNNGG 1 cut(s) 809
BssMI GATC 5 cut(s) 174, 245, 589, 594, 704
BssT1I CCWWGG 1 cut(s) 809
Bst2UI CCWGG 1 cut(s) 750
Bst4CI ACNGT 4 cut(s) 52, 62, 429, 582
Bst6I CTCTTC 3 cut(s) 159, 227, 677
BstC8I GCNNGC 2 cut(s) 575, 914
BstDEI CTNAG 3 cut(s) 117, 158, 692
BstF5I GGATG 3 cut(s) 235, 418, 523
BstKTI GATC 5 cut(s) 177, 248, 592, 597, 707
BstMAI GTCTC 3 cut(s) 68, 156, 682
BstMBI GATC 5 cut(s) 174, 245, 589, 594, 704
BstMWI GCNNNNNNNGC 2 cut(s) 26, 840
BstNI CCWGG 1 cut(s) 750
BstNSI RCATGY 1 cut(s) 863
BstSCI CCNGG 1 cut(s) 748
BstSFI CTRYAG 1 cut(s) 720
BstV1I GCAGC 8 cut(s) 41, 406, 500, 555, 582, 648, 830, 843
BstV2I GAAGAC 1 cut(s) 885
BstX2I RGATCY 2 cut(s) 594, 704
BstYI RGATCY 2 cut(s) 594, 704
BsuRI GGCC 1 cut(s) 234
BtgZI GCGATG 1 cut(s) 883
BtsCI GGATG 3 cut(s) 235, 418, 523
BtsI GCAGTG 3 cut(s) 625, 646, 729
BtsIMutI CAGTG 4 cut(s) 345, 625, 646, 729
Cac8I GCNNGC 2 cut(s) 575, 914
Cfr10I RCCGGY 1 cut(s) 434
Cfr13I GGNCC 1 cut(s) 233
CseI GACGC 1 cut(s) 480
CviAII CATG 6 cut(s) 164, 504, 514, 765, 835, 860
DdeI CTNAG 3 cut(s) 117, 158, 692
DpnI GATC 5 cut(s) 176, 247, 591, 596, 706
DpnII GATC 5 cut(s) 174, 245, 589, 594, 704
DriI GACNNNNNGTC 1 cut(s) 413
Eam1104I CTCTTC 3 cut(s) 159, 227, 677
Eam1105I GACNNNNNGTC 1 cut(s) 413
EarI CTCTTC 3 cut(s) 159, 227, 677
Eco130I CCWWGG 1 cut(s) 809
Eco24I GRGCYC 1 cut(s) 800
Eco57I CTGAAG 1 cut(s) 538
EcoRII CCWGG 1 cut(s) 748
EcoT14I CCWWGG 1 cut(s) 809
EcoT38I GRGCYC 1 cut(s) 800
ErhI CCWWGG 1 cut(s) 809
FaeI CATG 6 cut(s) 167, 507, 517, 768, 838, 863
FatI CATG 6 cut(s) 163, 503, 513, 764, 834, 859
FbaI TGATCA 1 cut(s) 589
Fnu4HI GCNGC 8 cut(s) 30, 395, 489, 544, 571, 637, 832, 844
FokI GGATG 3 cut(s) 242, 405, 530
FriOI GRGCYC 1 cut(s) 800
Fsp4HI GCNGC 8 cut(s) 30, 395, 489, 544, 571, 637, 832, 844
FspBI CTAG 3 cut(s) 329, 462, 810
GluI GCNGC 8 cut(s) 30, 395, 489, 544, 571, 637, 832, 844
GsaI CCCAGC 2 cut(s) 284, 851
HaeIII GGCC 1 cut(s) 234
HapII CCGG 1 cut(s) 435
HgaI GACGC 1 cut(s) 480
Hin1II CATG 6 cut(s) 167, 507, 517, 768, 838, 863
HindIII AAGCTT 1 cut(s) 359
HinfI GANTC 4 cut(s) 14, 160, 200, 727
HpaII CCGG 1 cut(s) 435
HphI GGTGA 4 cut(s) 424, 709, 764, 892
Hpy166II GTNNAC 1 cut(s) 432
Hpy188I TCNGA 7 cut(s) 159, 179, 250, 557, 589, 594, 732
Hpy188III TCNNGA 1 cut(s) 139
Hpy8I GTNNAC 1 cut(s) 432
Hpy99I CGWCG 1 cut(s) 496
HpyAV CCTTC 3 cut(s) 165, 562, 894
HpyCH4III ACNGT 4 cut(s) 52, 62, 429, 582
HpyCH4V TGCA 7 cut(s) 72, 112, 394, 449, 626, 722, 740
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 840
HpyF3I CTNAG 3 cut(s) 117, 158, 692
Hsp92II CATG 6 cut(s) 167, 507, 517, 768, 838, 863
Ksp22I TGATCA 1 cut(s) 589
Kzo9I GATC 5 cut(s) 174, 245, 589, 594, 704
LmnI GCTCC 1 cut(s) 615
LpnPI CCDG 9 cut(s) 294, 329, 351, 448, 507, 732, 735, 762, 861
Lsp1109I GCAGC 8 cut(s) 41, 406, 500, 555, 582, 648, 830, 843
LweI GCATC 2 cut(s) 508, 860
MaeI CTAG 3 cut(s) 329, 462, 810
MaeIII GTNAC 3 cut(s) 353, 399, 898
MalI GATC 5 cut(s) 176, 247, 591, 596, 706
MboI GATC 5 cut(s) 174, 245, 589, 594, 704
MboII GAAGA 8 cut(s) 146, 180, 199, 202, 214, 694, 714, 890
MflI RGATCY 2 cut(s) 594, 704
MhlI GDGCHC 2 cut(s) 800, 918
MluCI AATT 4 cut(s) 238, 272, 372, 673
MlyI GAGTC 2 cut(s) 169, 736
MmeI TCCRAC 1 cut(s) 324
MseI TTAA 3 cut(s) 57, 132, 453
MspI CCGG 1 cut(s) 435
MspR9I CCNGG 1 cut(s) 750
Mva1269I GAATGC 1 cut(s) 922
MvaI CCWGG 1 cut(s) 750
MwoI GCNNNNNNNGC 2 cut(s) 26, 840
NdeII GATC 5 cut(s) 174, 245, 589, 594, 704
NlaIII CATG 6 cut(s) 167, 507, 517, 768, 838, 863
NlaIV GGNNCC 1 cut(s) 717
NmuCI GTSAC 1 cut(s) 898
NspI RCATGY 1 cut(s) 863
PciI ACATGT 1 cut(s) 859
PctI GAATGC 1 cut(s) 922
PfeI GAWTC 2 cut(s) 14, 200
PkrI GCNGC 8 cut(s) 31, 396, 490, 545, 572, 638, 833, 845
PleI GAGTC 2 cut(s) 168, 735
PpsI GAGTC 2 cut(s) 168, 735
PscI ACATGT 1 cut(s) 859
PsiI TTATAA 1 cut(s) 822
Psp6I CCWGG 1 cut(s) 748
PspFI CCCAGC 2 cut(s) 280, 847
PspGI CCWGG 1 cut(s) 748
PspN4I GGNNCC 1 cut(s) 717
PspPI GGNCC 1 cut(s) 233
PstI CTGCAG 1 cut(s) 724
PsuI RGATCY 2 cut(s) 594, 704
SaqAI TTAA 3 cut(s) 57, 132, 453
SatI GCNGC 8 cut(s) 30, 395, 489, 544, 571, 637, 832, 844
Sau3AI GATC 5 cut(s) 174, 245, 589, 594, 704
Sau96I GGNCC 1 cut(s) 233
SchI GAGTC 2 cut(s) 169, 736
ScrFI CCNGG 1 cut(s) 750
SduI GDGCHC 2 cut(s) 800, 918
SetI ASST 9 cut(s) 12, 22, 198, 286, 303, 363, 447, 717, 905
SfaNI GCATC 2 cut(s) 508, 860
SfcI CTRYAG 1 cut(s) 720
Sse9I AATT 4 cut(s) 238, 272, 372, 673
SspMI CTAG 3 cut(s) 329, 462, 810
StyD4I CCNGG 1 cut(s) 748
StyI CCWWGG 1 cut(s) 809
TaaI ACNGT 4 cut(s) 52, 62, 429, 582
TaqI TCGA 2 cut(s) 198, 864
TasI AATT 4 cut(s) 238, 272, 372, 673
TfiI GAWTC 2 cut(s) 14, 200
Tru1I TTAA 3 cut(s) 57, 132, 453
Tru9I TTAA 3 cut(s) 57, 132, 453
TscAI CASTG 4 cut(s) 345, 625, 646, 729
TseFI GTSAC 1 cut(s) 898
TseI GCWGC 8 cut(s) 29, 394, 488, 543, 570, 636, 831, 843
Tsp45I GTSAC 1 cut(s) 898
TspDTI ATGAA 3 cut(s) 192, 487, 753
TspRI CASTG 4 cut(s) 345, 625, 646, 729
XceI RCATGY 1 cut(s) 863
XmaJI CCTAGG 1 cut(s) 809
XspI CTAG 3 cut(s) 329, 462, 810
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.