Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000157.1

Orthogroup ID

OG0011198

Physical Location & Seq

Genomic Coordinates Forward (+)

180409 .. 182969

Gene Structure 2561 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000157.1_g000039.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1101 bp

atggcagcttcaagttcgaaacctgtgtttggaggagatctttatgttgatgacttaattgcaagtagtgggaatggattagacttcacaaaaccggctggtgtgttttttaatgatagaagtcgtagcagcttcctgaaagctagcttgagtttgagaagaaaagaatcgttcaacggtcgtctagtttctgtgcatgttggaccttggttgagaaattttcatgcctcgtcttccatgtgctatgctgctggtgctgctcagaatgtgtcagttgatggcaactccaatgaagaacagcttgcaaattctacagttttgcctgatcaacctgttttgggagagagaactctgaagctactttcaggatcatgttacttgccacatcctgagaaggaggggacaggaggagaggatgcccacttcatttgtgaagatgcacaggcaattggtgtagcagatggtgtgggtggatgggctgatgttggtgttaatgccggactatttgcacgggaacttatgtctcattctgttaaggcaattcaagaggagcctaagggtagctttgaacccgccagggtgttggagaaggcccactcatgcaccaaagcaaagggttcttcaacagcttgcatcattggccttactgagaagggcttacatgctatcaatcttggagacagtggattcgtagtggttagagatggaagcaccatcttccgatcccctgttcagcagcatggcttcaattttacatatcagctggaaagtggcagtggggctgatctaccaagctccggtcaggtatttttgatacctgtcgctgcaggggatgtcattattgctgggacggatgggttgtttgacaatttgtataatagtgaggttactgctgttgttgttcatgccgtgagaactggcttggaaccacaagcaaccgcacagaaaatagcagctttagcacgccagcgagcactagataagaacaggcaaacaccattttccactgctgctcaagatgcagggttccgttactatggagggaagcttgatgatgtcacggttgttgtgtccttcataactagctccatcaaggtgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PP2C_2 SpoIIE

Protein Analysis

366

Amino Acids

38.6

Weight (kDa)

5.86

Isoelectric Point (pI)

36.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011198)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G66720 AT5G66720
fragaria_vesca	FvH4_1g13720 FvH4_1g13720
malus_domestica	MD02G1151900.v1.1 MD15G1266300.v1.1
prunus_persica	Prupe.7G151100_v2.0.a1
pyrus_communis	pycom02g11930 pycom15g23180
rosa_chinensis	RchiOBHm_Chr2g0102131
rosa_laevigata	RLG00000017132
rosa_multiflora	Rmu_co8315037.1_g000001 Rmu_sc0000157.1_g000039
rosa_roxburghii	Rroxscaffold_2G00140760
rosa_rugosa	Rorug02G0104600
rosa_samantha	Rh2AG153000 Rh2BG158900 Rh2CG158200 Rh2DG158600
rosa_wichuraiana	Rw2G011940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	573, 939
AclWI	GGATC	2 cut(s)	376, 717
AcsI	RAATTY	2 cut(s)	217, 307
AcuI	CTGAAG	1 cut(s)	374
AfiI	CCNNNNNNNGG	3 cut(s)	29, 338, 797
AgsI	TTSAA	6 cut(s)	12, 175, 545, 569, 624, 748
AjnI	CCWGG	1 cut(s)	575
Alw21I	GWGCWC	1 cut(s)	976
Alw26I	GTCTC	2 cut(s)	528, 672
AlwI	GGATC	2 cut(s)	376, 717
AoxI	GGCC	2 cut(s)	591, 640
ApeKI	GCWGC	8 cut(s)	5, 129, 248, 257, 736, 824, 953, 1010
ApoI	RAATTY	2 cut(s)	217, 307
ArsI	GACNNNNNNTTYG	2 cut(s)	671, 703
AspS9I	GGNCC	2 cut(s)	203, 592
AsuII	TTCGAA	1 cut(s)	17
AsuNHI	GCTAGC	1 cut(s)	143
AvaII	GGWCC	1 cut(s)	203
AxyI	CCTNAGG	1 cut(s)	555
BbsI	GAAGAC	1 cut(s)	225
Bbv12I	GWGCWC	1 cut(s)	976
BbvI	GCAGC	8 cut(s)	17, 141, 235, 244, 748, 811, 965, 997
BccI	CCATC	7 cut(s)	272, 455, 468, 698, 722, 848, 1097
BceAI	ACGGC	1 cut(s)	893
BciT130I	CCWGG	1 cut(s)	577
BclI	TGATCA	1 cut(s)	325
BcoDI	GTCTC	2 cut(s)	528, 672
BfaI	CTAG	4 cut(s)	144, 185, 977, 1083
BfmI	CTRYAG	2 cut(s)	312, 825
BglII	AGATCT	1 cut(s)	37
BisI	GCNGC	8 cut(s)	6, 130, 249, 258, 737, 825, 954, 1011
BlsI	GCNGC	8 cut(s)	7, 131, 250, 259, 738, 826, 955, 1012
Bme1390I	CCNGG	1 cut(s)	577
Bme18I	GGWCC	1 cut(s)	203
BmgT120I	GGNCC	2 cut(s)	203, 592
BmiI	GGNNCC	3 cut(s)	552, 927, 1028
BmrFI	CCNGG	1 cut(s)	577
BmsI	GCATC	4 cut(s)	406, 427, 642, 1009
BmtI	GCTAGC	1 cut(s)	147
BpiI	GAAGAC	1 cut(s)	225
Bpu14I	TTCGAA	1 cut(s)	17
BpuEI	CTTGAG	2 cut(s)	169, 999
BsaJI	CCNNGG	2 cut(s)	206, 576
BsaWI	WCCGGW	1 cut(s)	797
Bsc4I	CCNNNNNNNGG	3 cut(s)	29, 338, 797
Bse118I	RCCGGY	1 cut(s)	94
Bse1I	ACTGG	1 cut(s)	922
Bse21I	CCTNAGG	1 cut(s)	555
BseBI	CCWGG	1 cut(s)	577
BseDI	CCNNGG	2 cut(s)	206, 576
BseGI	GGATG	5 cut(s)	385, 421, 479, 838, 859
BseLI	CCNNNNNNNGG	3 cut(s)	29, 338, 797
BseMII	CTCAG	3 cut(s)	275, 381, 639
BseNI	ACTGG	1 cut(s)	922
BseRI	GAGGAG	3 cut(s)	48, 423, 563
BseXI	GCAGC	8 cut(s)	17, 141, 235, 244, 748, 811, 965, 997
BseYI	CCCAGC	1 cut(s)	845
Bsh1285I	CGRYCG	1 cut(s)	181
BshFI	GGCC	2 cut(s)	593, 642
BsiEI	CGRYCG	1 cut(s)	181
BsiHKAI	GWGCWC	1 cut(s)	976
BsiSI	CCGG	3 cut(s)	95, 498, 798
BslFI	GGGAC	2 cut(s)	415, 862
BslI	CCNNNNNNNGG	3 cut(s)	29, 338, 797
BsmAI	GTCTC	2 cut(s)	528, 672
BsmFI	GGGAC	2 cut(s)	415, 862
BsnI	GGCC	2 cut(s)	593, 642
Bsp119I	TTCGAA	1 cut(s)	17
Bsp1286I	GDGCHC	1 cut(s)	976
Bsp143I	GATC	5 cut(s)	37, 325, 368, 722, 784
BspACI	CCGC	2 cut(s)	573, 939
BspANI	GGCC	2 cut(s)	593, 642
BspCNI	CTCAG	3 cut(s)	274, 382, 640
BspLI	GGNNCC	3 cut(s)	552, 927, 1028
BspMAI	CTGCAG	1 cut(s)	829
BspOI	GCTAGC	1 cut(s)	147
BspPI	GGATC	2 cut(s)	376, 717
BspT104I	TTCGAA	1 cut(s)	17
BsrFI	RCCGGY	1 cut(s)	94
BsrI	ACTGG	1 cut(s)	922
BssAI	RCCGGY	1 cut(s)	94
BssECI	CCNNGG	2 cut(s)	206, 576
BssMI	GATC	5 cut(s)	37, 325, 368, 722, 784
BssT1I	CCWWGG	1 cut(s)	206
Bst2UI	CCWGG	1 cut(s)	577
Bst4CI	ACNGT	4 cut(s)	179, 316, 683, 1063
BstBI	TTCGAA	1 cut(s)	17
BstC8I	GCNNGC	6 cut(s)	145, 303, 631, 964, 968, 972
BstDEI	CTNAG	4 cut(s)	261, 390, 555, 648
BstF5I	GGATG	5 cut(s)	385, 421, 479, 838, 859
BstKTI	GATC	5 cut(s)	40, 328, 371, 725, 787
BstMAI	GTCTC	2 cut(s)	528, 672
BstMBI	GATC	5 cut(s)	37, 325, 368, 722, 784
BstMCI	CGRYCG	1 cut(s)	181
BstMWI	GCNNNNNNNGC	5 cut(s)	254, 257, 639, 959, 1019
BstNI	CCWGG	1 cut(s)	577
BstNSI	RCATGY	2 cut(s)	200, 665
BstSCI	CCNGG	1 cut(s)	575
BstSFI	CTRYAG	2 cut(s)	312, 825
BstV1I	GCAGC	8 cut(s)	17, 141, 235, 244, 748, 811, 965, 997
BstV2I	GAAGAC	1 cut(s)	225
BstX2I	RGATCY	1 cut(s)	37
BstXI	CCANNNNNNTGG	1 cut(s)	583
BstYI	RGATCY	1 cut(s)	37
Bsu36I	CCTNAGG	1 cut(s)	555
BsuRI	GGCC	2 cut(s)	593, 642
BtsCI	GGATG	5 cut(s)	385, 421, 479, 838, 859
BtsI	GCAGTG	2 cut(s)	781, 1005
BtsIMutI	CAGTG	3 cut(s)	688, 781, 1005
Cac8I	GCNNGC	6 cut(s)	145, 303, 631, 964, 968, 972
Cfr10I	RCCGGY	1 cut(s)	94
Cfr13I	GGNCC	2 cut(s)	203, 592
CspCI	CAANNNNNGTGG	2 cut(s)	410, 445
CviAII	CATG	8 cut(s)	197, 224, 238, 372, 600, 662, 740, 905
DdeI	CTNAG	4 cut(s)	261, 390, 555, 648
DpnI	GATC	5 cut(s)	39, 327, 370, 724, 786
DpnII	GATC	5 cut(s)	37, 325, 368, 722, 784
Eco130I	CCWWGG	1 cut(s)	206
Eco47I	GGWCC	1 cut(s)	203
Eco57I	CTGAAG	1 cut(s)	374
Eco81I	CCTNAGG	1 cut(s)	555
EcoRII	CCWGG	1 cut(s)	575
EcoT14I	CCWWGG	1 cut(s)	206
ErhI	CCWWGG	1 cut(s)	206
FaeI	CATG	8 cut(s)	200, 227, 241, 375, 603, 665, 743, 908
FalI	AAGNNNNNCTT	4 cut(s)	285, 317, 548, 580
FaqI	GGGAC	2 cut(s)	415, 862
FatI	CATG	8 cut(s)	196, 223, 237, 371, 599, 661, 739, 904
FauI	CCCGC	1 cut(s)	580
FbaI	TGATCA	1 cut(s)	325
Fnu4HI	GCNGC	8 cut(s)	6, 130, 249, 258, 737, 825, 954, 1011
FokI	GGATG	5 cut(s)	372, 428, 486, 845, 866
Fsp4HI	GCNGC	8 cut(s)	6, 130, 249, 258, 737, 825, 954, 1011
FspBI	CTAG	4 cut(s)	144, 185, 977, 1083
GluI	GCNGC	8 cut(s)	6, 130, 249, 258, 737, 825, 954, 1011
GsaI	CCCAGC	1 cut(s)	849
HaeIII	GGCC	2 cut(s)	593, 642
HapII	CCGG	3 cut(s)	95, 498, 798
Hin1II	CATG	8 cut(s)	200, 227, 241, 375, 603, 665, 743, 908
HindIII	AAGCTT	1 cut(s)	1046
HinfI	GANTC	2 cut(s)	167, 687
HpaII	CCGG	3 cut(s)	95, 498, 798
Hpy188I	TCNGA	3 cut(s)	264, 354, 722
Hpy188III	TCNNGA	5 cut(s)	136, 366, 389, 545, 1016
HpyAV	CCTTC	4 cut(s)	388, 583, 646, 1084
HpyCH4III	ACNGT	4 cut(s)	179, 316, 683, 1063
HpyCH4V	TGCA	9 cut(s)	62, 196, 305, 440, 509, 603, 633, 827, 1022
HpyF10VI	GCNNNNNNNGC	5 cut(s)	254, 257, 639, 959, 1019
HpyF3I	CTNAG	4 cut(s)	261, 390, 555, 648
Hsp92II	CATG	8 cut(s)	200, 227, 241, 375, 603, 665, 743, 908
Ksp22I	TGATCA	1 cut(s)	325
Kzo9I	GATC	5 cut(s)	37, 325, 368, 722, 784
LmnI	GCTCC	3 cut(s)	550, 800, 1091
Lsp1109I	GCAGC	8 cut(s)	17, 141, 235, 244, 748, 811, 965, 997
LweI	GCATC	4 cut(s)	406, 427, 642, 1009
MaeI	CTAG	4 cut(s)	144, 185, 977, 1083
MaeIII	GTNAC	4 cut(s)	374, 886, 1031, 1057
MalI	GATC	5 cut(s)	39, 327, 370, 724, 786
MboI	GATC	5 cut(s)	37, 325, 368, 722, 784
MboII	GAAGA	6 cut(s)	171, 225, 305, 446, 612, 709
MfeI	CAATTG	1 cut(s)	447
MflI	RGATCY	1 cut(s)	37
MhlI	GDGCHC	1 cut(s)	976
MluCI	AATT	7 cut(s)	57, 217, 307, 447, 540, 748, 868
MmeI	TCCRAC	2 cut(s)	181, 564
MnlI	CCTC	8 cut(s)	26, 238, 391, 401, 406, 541, 877, 1034
MseI	TTAA	4 cut(s)	56, 111, 492, 534
MslI	CAYNNNNRTG	1 cut(s)	1094
MspA1I	CMGCKG	1 cut(s)	763
MspI	CCGG	3 cut(s)	95, 498, 798
MspR9I	CCNGG	1 cut(s)	577
MunI	CAATTG	1 cut(s)	447
MvaI	CCWGG	1 cut(s)	577
MwoI	GCNNNNNNNGC	5 cut(s)	254, 257, 639, 959, 1019
NdeII	GATC	5 cut(s)	37, 325, 368, 722, 784
NheI	GCTAGC	1 cut(s)	143
NlaIII	CATG	8 cut(s)	200, 227, 241, 375, 603, 665, 743, 908
NlaIV	GGNNCC	3 cut(s)	552, 927, 1028
NmuCI	GTSAC	1 cut(s)	1057
NspI	RCATGY	2 cut(s)	200, 665
NspV	TTCGAA	1 cut(s)	17
PfeI	GAWTC	2 cut(s)	167, 687
PkrI	GCNGC	8 cut(s)	7, 131, 250, 259, 738, 826, 955, 1012
Psp6I	CCWGG	1 cut(s)	575
PspFI	CCCAGC	1 cut(s)	845
PspGI	CCWGG	1 cut(s)	575
PspN4I	GGNNCC	3 cut(s)	552, 927, 1028
PspPI	GGNCC	2 cut(s)	203, 592
PstI	CTGCAG	1 cut(s)	829
PsuI	RGATCY	1 cut(s)	37
PvuII	CAGCTG	1 cut(s)	763
RseI	CAYNNNNRTG	1 cut(s)	1094
SaqAI	TTAA	4 cut(s)	56, 111, 492, 534
SatI	GCNGC	8 cut(s)	6, 130, 249, 258, 737, 825, 954, 1011
Sau3AI	GATC	5 cut(s)	37, 325, 368, 722, 784
Sau96I	GGNCC	2 cut(s)	203, 592
ScrFI	CCNGG	1 cut(s)	577
SduI	GDGCHC	1 cut(s)	976
SfaNI	GCATC	4 cut(s)	406, 427, 642, 1009
SfcI	CTRYAG	2 cut(s)	312, 825
SfuI	TTCGAA	1 cut(s)	17
SinI	GGWCC	1 cut(s)	203
SmiMI	CAYNNNNRTG	1 cut(s)	1094
SmlI	CTYRAG	2 cut(s)	148, 1014
SmoI	CTYRAG	2 cut(s)	148, 1014
Sse9I	AATT	7 cut(s)	57, 217, 307, 447, 540, 748, 868
SsiI	CCGC	2 cut(s)	573, 939
SspMI	CTAG	4 cut(s)	144, 185, 977, 1083
StyD4I	CCNGG	1 cut(s)	575
StyI	CCWWGG	1 cut(s)	206
TaaI	ACNGT	4 cut(s)	179, 316, 683, 1063
TaqI	TCGA	1 cut(s)	17
TasI	AATT	7 cut(s)	57, 217, 307, 447, 540, 748, 868
TfiI	GAWTC	2 cut(s)	167, 687
Tru1I	TTAA	4 cut(s)	56, 111, 492, 534
Tru9I	TTAA	4 cut(s)	56, 111, 492, 534
TscAI	CASTG	3 cut(s)	688, 781, 1012
TseFI	GTSAC	1 cut(s)	1057
TseI	GCWGC	8 cut(s)	5, 129, 248, 257, 736, 824, 953, 1010
Tsp45I	GTSAC	1 cut(s)	1057
TspDTI	ATGAA	5 cut(s)	212, 306, 415, 893, 1066
TspGWI	ACGGA	2 cut(s)	866, 1019
TspRI	CASTG	3 cut(s)	688, 781, 1012
VpaK11BI	GGWCC	1 cut(s)	203
XapI	RAATTY	2 cut(s)	217, 307
XceI	RCATGY	2 cut(s)	200, 665
XspI	CTAG	4 cut(s)	144, 185, 977, 1083

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.