Rmu_sc0000157.1_g000039

phosphatase 2c

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000157.1
OG0011198
Physical Location & Seq
Forward (+)
180409 .. 182969
2561 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1101 bp
atggcagcttcaagttcgaaacctgtgtttggaggagatctttatgttgatgacttaattgcaagtagtgggaatggattagacttcacaaaaccggctggtgtgttttttaatgatagaagtcgtagcagcttcctgaaagctagcttgagtttgagaagaaaagaatcgttcaacggtcgtctagtttctgtgcatgttggaccttggttgagaaattttcatgcctcgtcttccatgtgctatgctgctggtgctgctcagaatgtgtcagttgatggcaactccaatgaagaacagcttgcaaattctacagttttgcctgatcaacctgttttgggagagagaactctgaagctactttcaggatcatgttacttgccacatcctgagaaggaggggacaggaggagaggatgcccacttcatttgtgaagatgcacaggcaattggtgtagcagatggtgtgggtggatgggctgatgttggtgttaatgccggactatttgcacgggaacttatgtctcattctgttaaggcaattcaagaggagcctaagggtagctttgaacccgccagggtgttggagaaggcccactcatgcaccaaagcaaagggttcttcaacagcttgcatcattggccttactgagaagggcttacatgctatcaatcttggagacagtggattcgtagtggttagagatggaagcaccatcttccgatcccctgttcagcagcatggcttcaattttacatatcagctggaaagtggcagtggggctgatctaccaagctccggtcaggtatttttgatacctgtcgctgcaggggatgtcattattgctgggacggatgggttgtttgacaatttgtataatagtgaggttactgctgttgttgttcatgccgtgagaactggcttggaaccacaagcaaccgcacagaaaatagcagctttagcacgccagcgagcactagataagaacaggcaaacaccattttccactgctgctcaagatgcagggttccgttactatggagggaagcttgatgatgtcacggttgttgtgtccttcataactagctccatcaaggtgtga

Protein Analysis

366

Amino Acids

38.6

Weight (kDa)

5.86

Isoelectric Point (pI)

36.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2C_2 PF13672 132 - 317 1.6e-06 Protein phosphatase 2C
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011198)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G66720 AT5G66720
fragaria_vesca FvH4_1g13720 FvH4_1g13720
malus_domestica MD02G1151900.v1.1 MD15G1266300.v1.1
prunus_persica Prupe.7G151100_v2.0.a1
pyrus_communis pycom02g11930 pycom15g23180
rosa_chinensis RchiOBHm_Chr2g0102131
rosa_laevigata RLG00000017132
rosa_multiflora Rmu_co8315037.1_g000001 Rmu_sc0000157.1_g000039
rosa_roxburghii Rroxscaffold_2G00140760
rosa_rugosa Rorug02G0104600
rosa_samantha Rh2AG153000 Rh2BG158900 Rh2CG158200 Rh2DG158600
rosa_wichuraiana Rw2G011940

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 573, 939
AclWI GGATC 2 cut(s) 376, 717
AcsI RAATTY 2 cut(s) 217, 307
AcuI CTGAAG 1 cut(s) 374
AfiI CCNNNNNNNGG 3 cut(s) 29, 338, 797
AgsI TTSAA 6 cut(s) 12, 175, 545, 569, 624, 748
AjnI CCWGG 1 cut(s) 575
Alw21I GWGCWC 1 cut(s) 976
Alw26I GTCTC 2 cut(s) 528, 672
AlwI GGATC 2 cut(s) 376, 717
AoxI GGCC 2 cut(s) 591, 640
ApeKI GCWGC 8 cut(s) 5, 129, 248, 257, 736, 824, 953, 1010
ApoI RAATTY 2 cut(s) 217, 307
ArsI GACNNNNNNTTYG 2 cut(s) 671, 703
AspS9I GGNCC 2 cut(s) 203, 592
AsuII TTCGAA 1 cut(s) 17
AsuNHI GCTAGC 1 cut(s) 143
AvaII GGWCC 1 cut(s) 203
AxyI CCTNAGG 1 cut(s) 555
BbsI GAAGAC 1 cut(s) 225
Bbv12I GWGCWC 1 cut(s) 976
BbvI GCAGC 8 cut(s) 17, 141, 235, 244, 748, 811, 965, 997
BccI CCATC 7 cut(s) 272, 455, 468, 698, 722, 848, 1097
BceAI ACGGC 1 cut(s) 893
BciT130I CCWGG 1 cut(s) 577
BclI TGATCA 1 cut(s) 325
BcoDI GTCTC 2 cut(s) 528, 672
BfaI CTAG 4 cut(s) 144, 185, 977, 1083
BfmI CTRYAG 2 cut(s) 312, 825
BglII AGATCT 1 cut(s) 37
BisI GCNGC 8 cut(s) 6, 130, 249, 258, 737, 825, 954, 1011
BlsI GCNGC 8 cut(s) 7, 131, 250, 259, 738, 826, 955, 1012
Bme1390I CCNGG 1 cut(s) 577
Bme18I GGWCC 1 cut(s) 203
BmgT120I GGNCC 2 cut(s) 203, 592
BmiI GGNNCC 3 cut(s) 552, 927, 1028
BmrFI CCNGG 1 cut(s) 577
BmsI GCATC 4 cut(s) 406, 427, 642, 1009
BmtI GCTAGC 1 cut(s) 147
BpiI GAAGAC 1 cut(s) 225
Bpu14I TTCGAA 1 cut(s) 17
BpuEI CTTGAG 2 cut(s) 169, 999
BsaJI CCNNGG 2 cut(s) 206, 576
BsaWI WCCGGW 1 cut(s) 797
Bsc4I CCNNNNNNNGG 3 cut(s) 29, 338, 797
Bse118I RCCGGY 1 cut(s) 94
Bse1I ACTGG 1 cut(s) 922
Bse21I CCTNAGG 1 cut(s) 555
BseBI CCWGG 1 cut(s) 577
BseDI CCNNGG 2 cut(s) 206, 576
BseGI GGATG 5 cut(s) 385, 421, 479, 838, 859
BseLI CCNNNNNNNGG 3 cut(s) 29, 338, 797
BseMII CTCAG 3 cut(s) 275, 381, 639
BseNI ACTGG 1 cut(s) 922
BseRI GAGGAG 3 cut(s) 48, 423, 563
BseXI GCAGC 8 cut(s) 17, 141, 235, 244, 748, 811, 965, 997
BseYI CCCAGC 1 cut(s) 845
Bsh1285I CGRYCG 1 cut(s) 181
BshFI GGCC 2 cut(s) 593, 642
BsiEI CGRYCG 1 cut(s) 181
BsiHKAI GWGCWC 1 cut(s) 976
BsiSI CCGG 3 cut(s) 95, 498, 798
BslFI GGGAC 2 cut(s) 415, 862
BslI CCNNNNNNNGG 3 cut(s) 29, 338, 797
BsmAI GTCTC 2 cut(s) 528, 672
BsmFI GGGAC 2 cut(s) 415, 862
BsnI GGCC 2 cut(s) 593, 642
Bsp119I TTCGAA 1 cut(s) 17
Bsp1286I GDGCHC 1 cut(s) 976
Bsp143I GATC 5 cut(s) 37, 325, 368, 722, 784
BspACI CCGC 2 cut(s) 573, 939
BspANI GGCC 2 cut(s) 593, 642
BspCNI CTCAG 3 cut(s) 274, 382, 640
BspLI GGNNCC 3 cut(s) 552, 927, 1028
BspMAI CTGCAG 1 cut(s) 829
BspOI GCTAGC 1 cut(s) 147
BspPI GGATC 2 cut(s) 376, 717
BspT104I TTCGAA 1 cut(s) 17
BsrFI RCCGGY 1 cut(s) 94
BsrI ACTGG 1 cut(s) 922
BssAI RCCGGY 1 cut(s) 94
BssECI CCNNGG 2 cut(s) 206, 576
BssMI GATC 5 cut(s) 37, 325, 368, 722, 784
BssT1I CCWWGG 1 cut(s) 206
Bst2UI CCWGG 1 cut(s) 577
Bst4CI ACNGT 4 cut(s) 179, 316, 683, 1063
BstBI TTCGAA 1 cut(s) 17
BstC8I GCNNGC 6 cut(s) 145, 303, 631, 964, 968, 972
BstDEI CTNAG 4 cut(s) 261, 390, 555, 648
BstF5I GGATG 5 cut(s) 385, 421, 479, 838, 859
BstKTI GATC 5 cut(s) 40, 328, 371, 725, 787
BstMAI GTCTC 2 cut(s) 528, 672
BstMBI GATC 5 cut(s) 37, 325, 368, 722, 784
BstMCI CGRYCG 1 cut(s) 181
BstMWI GCNNNNNNNGC 5 cut(s) 254, 257, 639, 959, 1019
BstNI CCWGG 1 cut(s) 577
BstNSI RCATGY 2 cut(s) 200, 665
BstSCI CCNGG 1 cut(s) 575
BstSFI CTRYAG 2 cut(s) 312, 825
BstV1I GCAGC 8 cut(s) 17, 141, 235, 244, 748, 811, 965, 997
BstV2I GAAGAC 1 cut(s) 225
BstX2I RGATCY 1 cut(s) 37
BstXI CCANNNNNNTGG 1 cut(s) 583
BstYI RGATCY 1 cut(s) 37
Bsu36I CCTNAGG 1 cut(s) 555
BsuRI GGCC 2 cut(s) 593, 642
BtsCI GGATG 5 cut(s) 385, 421, 479, 838, 859
BtsI GCAGTG 2 cut(s) 781, 1005
BtsIMutI CAGTG 3 cut(s) 688, 781, 1005
Cac8I GCNNGC 6 cut(s) 145, 303, 631, 964, 968, 972
Cfr10I RCCGGY 1 cut(s) 94
Cfr13I GGNCC 2 cut(s) 203, 592
CspCI CAANNNNNGTGG 2 cut(s) 410, 445
CviAII CATG 8 cut(s) 197, 224, 238, 372, 600, 662, 740, 905
DdeI CTNAG 4 cut(s) 261, 390, 555, 648
DpnI GATC 5 cut(s) 39, 327, 370, 724, 786
DpnII GATC 5 cut(s) 37, 325, 368, 722, 784
Eco130I CCWWGG 1 cut(s) 206
Eco47I GGWCC 1 cut(s) 203
Eco57I CTGAAG 1 cut(s) 374
Eco81I CCTNAGG 1 cut(s) 555
EcoRII CCWGG 1 cut(s) 575
EcoT14I CCWWGG 1 cut(s) 206
ErhI CCWWGG 1 cut(s) 206
FaeI CATG 8 cut(s) 200, 227, 241, 375, 603, 665, 743, 908
FalI AAGNNNNNCTT 4 cut(s) 285, 317, 548, 580
FaqI GGGAC 2 cut(s) 415, 862
FatI CATG 8 cut(s) 196, 223, 237, 371, 599, 661, 739, 904
FauI CCCGC 1 cut(s) 580
FbaI TGATCA 1 cut(s) 325
Fnu4HI GCNGC 8 cut(s) 6, 130, 249, 258, 737, 825, 954, 1011
FokI GGATG 5 cut(s) 372, 428, 486, 845, 866
Fsp4HI GCNGC 8 cut(s) 6, 130, 249, 258, 737, 825, 954, 1011
FspBI CTAG 4 cut(s) 144, 185, 977, 1083
GluI GCNGC 8 cut(s) 6, 130, 249, 258, 737, 825, 954, 1011
GsaI CCCAGC 1 cut(s) 849
HaeIII GGCC 2 cut(s) 593, 642
HapII CCGG 3 cut(s) 95, 498, 798
Hin1II CATG 8 cut(s) 200, 227, 241, 375, 603, 665, 743, 908
HindIII AAGCTT 1 cut(s) 1046
HinfI GANTC 2 cut(s) 167, 687
HpaII CCGG 3 cut(s) 95, 498, 798
Hpy188I TCNGA 3 cut(s) 264, 354, 722
Hpy188III TCNNGA 5 cut(s) 136, 366, 389, 545, 1016
HpyAV CCTTC 4 cut(s) 388, 583, 646, 1084
HpyCH4III ACNGT 4 cut(s) 179, 316, 683, 1063
HpyCH4V TGCA 9 cut(s) 62, 196, 305, 440, 509, 603, 633, 827, 1022
HpyF10VI GCNNNNNNNGC 5 cut(s) 254, 257, 639, 959, 1019
HpyF3I CTNAG 4 cut(s) 261, 390, 555, 648
Hsp92II CATG 8 cut(s) 200, 227, 241, 375, 603, 665, 743, 908
Ksp22I TGATCA 1 cut(s) 325
Kzo9I GATC 5 cut(s) 37, 325, 368, 722, 784
LmnI GCTCC 3 cut(s) 550, 800, 1091
Lsp1109I GCAGC 8 cut(s) 17, 141, 235, 244, 748, 811, 965, 997
LweI GCATC 4 cut(s) 406, 427, 642, 1009
MaeI CTAG 4 cut(s) 144, 185, 977, 1083
MaeIII GTNAC 4 cut(s) 374, 886, 1031, 1057
MalI GATC 5 cut(s) 39, 327, 370, 724, 786
MboI GATC 5 cut(s) 37, 325, 368, 722, 784
MboII GAAGA 6 cut(s) 171, 225, 305, 446, 612, 709
MfeI CAATTG 1 cut(s) 447
MflI RGATCY 1 cut(s) 37
MhlI GDGCHC 1 cut(s) 976
MluCI AATT 7 cut(s) 57, 217, 307, 447, 540, 748, 868
MmeI TCCRAC 2 cut(s) 181, 564
MnlI CCTC 8 cut(s) 26, 238, 391, 401, 406, 541, 877, 1034
MseI TTAA 4 cut(s) 56, 111, 492, 534
MslI CAYNNNNRTG 1 cut(s) 1094
MspA1I CMGCKG 1 cut(s) 763
MspI CCGG 3 cut(s) 95, 498, 798
MspR9I CCNGG 1 cut(s) 577
MunI CAATTG 1 cut(s) 447
MvaI CCWGG 1 cut(s) 577
MwoI GCNNNNNNNGC 5 cut(s) 254, 257, 639, 959, 1019
NdeII GATC 5 cut(s) 37, 325, 368, 722, 784
NheI GCTAGC 1 cut(s) 143
NlaIII CATG 8 cut(s) 200, 227, 241, 375, 603, 665, 743, 908
NlaIV GGNNCC 3 cut(s) 552, 927, 1028
NmuCI GTSAC 1 cut(s) 1057
NspI RCATGY 2 cut(s) 200, 665
NspV TTCGAA 1 cut(s) 17
PfeI GAWTC 2 cut(s) 167, 687
PkrI GCNGC 8 cut(s) 7, 131, 250, 259, 738, 826, 955, 1012
Psp6I CCWGG 1 cut(s) 575
PspFI CCCAGC 1 cut(s) 845
PspGI CCWGG 1 cut(s) 575
PspN4I GGNNCC 3 cut(s) 552, 927, 1028
PspPI GGNCC 2 cut(s) 203, 592
PstI CTGCAG 1 cut(s) 829
PsuI RGATCY 1 cut(s) 37
PvuII CAGCTG 1 cut(s) 763
RseI CAYNNNNRTG 1 cut(s) 1094
SaqAI TTAA 4 cut(s) 56, 111, 492, 534
SatI GCNGC 8 cut(s) 6, 130, 249, 258, 737, 825, 954, 1011
Sau3AI GATC 5 cut(s) 37, 325, 368, 722, 784
Sau96I GGNCC 2 cut(s) 203, 592
ScrFI CCNGG 1 cut(s) 577
SduI GDGCHC 1 cut(s) 976
SfaNI GCATC 4 cut(s) 406, 427, 642, 1009
SfcI CTRYAG 2 cut(s) 312, 825
SfuI TTCGAA 1 cut(s) 17
SinI GGWCC 1 cut(s) 203
SmiMI CAYNNNNRTG 1 cut(s) 1094
SmlI CTYRAG 2 cut(s) 148, 1014
SmoI CTYRAG 2 cut(s) 148, 1014
Sse9I AATT 7 cut(s) 57, 217, 307, 447, 540, 748, 868
SsiI CCGC 2 cut(s) 573, 939
SspMI CTAG 4 cut(s) 144, 185, 977, 1083
StyD4I CCNGG 1 cut(s) 575
StyI CCWWGG 1 cut(s) 206
TaaI ACNGT 4 cut(s) 179, 316, 683, 1063
TaqI TCGA 1 cut(s) 17
TasI AATT 7 cut(s) 57, 217, 307, 447, 540, 748, 868
TfiI GAWTC 2 cut(s) 167, 687
Tru1I TTAA 4 cut(s) 56, 111, 492, 534
Tru9I TTAA 4 cut(s) 56, 111, 492, 534
TscAI CASTG 3 cut(s) 688, 781, 1012
TseFI GTSAC 1 cut(s) 1057
TseI GCWGC 8 cut(s) 5, 129, 248, 257, 736, 824, 953, 1010
Tsp45I GTSAC 1 cut(s) 1057
TspDTI ATGAA 5 cut(s) 212, 306, 415, 893, 1066
TspGWI ACGGA 2 cut(s) 866, 1019
TspRI CASTG 3 cut(s) 688, 781, 1012
VpaK11BI GGWCC 1 cut(s) 203
XapI RAATTY 2 cut(s) 217, 307
XceI RCATGY 2 cut(s) 200, 665
XspI CTAG 4 cut(s) 144, 185, 977, 1083
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.