Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000206.1

Orthogroup ID

OG0011152

Physical Location & Seq

Genomic Coordinates Reverse (-)

54781 .. 55701

Gene Structure 921 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000206.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 690 bp

atgggaagcgtcactgaggaagagctagttcaaatggtgacagacttcattgaatcctcagagtcggttcctgactcattatcttctcccaaatcccctcgtcaatccaagtctctaactctacaggagataatatggaaggcaacagatcatgagaatgagatacttgacaaaatatcaatttatttgagggacctagagagtatgattcatcaacctaagaatctgaagaacaaatgggttgtgatgaaactgaaaatggatggttatgaagcctctctttgtaaaacttcatgggtttcttctgttaaactccccgaagtttatgaatttacagatgactatgaatatgttgatgttatggtgaaggacaacaatttactcaaggtgacaaggttaatagtggacatggatttcaagtcacaatttgagcttgcaagaccatcaccaagctacaaaaagctgaaagacattttgccagacatttttgttgggactgaagaaaagcttgataaagtcatatctctggtttgctcagctgcaacgaaatctctcaagaaaatgggtcttcatgttcctccatggagaaaagccacctacatgcaatccaagtggctctccaaagattgcaagaaaatctcaatctcacccacaaacatggaattgggtatcatctcccaaatgcactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PDDEXK_6

Protein Analysis

229

Amino Acids

26.32

Weight (kDa)

6.45

Isoelectric Point (pI)

46.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011152)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G77145 AT1G77145 AT1G77160 AT1G77160
malus_domestica	MD10G1016300.v1.1
prunus_persica	Prupe.8G020000_v2.0.a1 Prupe.8G020000_v2.0.a1 Prupe.8G020000_v2.0.a1
pyrus_communis	pycom05g00920
rosa_chinensis	RchiOBHm_Chr6g0277051
rosa_laevigata	RLG00000013341
rosa_multiflora	Rmu_sc0000206.1_g000008
rosa_roxburghii	Rroxscaffold_7G00191730
rosa_rugosa	Rorug06G0105900 Rorug06G0106000
rosa_samantha	Rh6AG215900 Rh6BG220500 Rh6CG223300 Rh6DG212900
rosa_wichuraiana	Rw6G018840

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	329
AcuI	CTGAAG	2 cut(s)	248, 519
AgsI	TTSAA	3 cut(s)	32, 53, 418
AluBI	AGCT	6 cut(s)	25, 433, 453, 463, 508, 539
AluI	AGCT	6 cut(s)	25, 433, 453, 463, 508, 539
Alw26I	GTCTC	1 cut(s)	117
ApeKI	GCWGC	1 cut(s)	539
ApoI	RAATTY	1 cut(s)	329
AspS9I	GGNCC	1 cut(s)	193
AsuHPI	GGTGA	5 cut(s)	49, 376, 400, 438, 639
AvaII	GGWCC	1 cut(s)	193
BbsI	GAAGAC	1 cut(s)	560
BbvI	GCAGC	1 cut(s)	526
BccI	CCATC	2 cut(s)	257, 451
BcoDI	GTCTC	1 cut(s)	117
BfaI	CTAG	3 cut(s)	26, 197, 688
BfmI	CTRYAG	1 cut(s)	122
BisI	GCNGC	1 cut(s)	540
BlpI	GCTNAGC	1 cut(s)	535
BlsI	GCNGC	1 cut(s)	541
Bme18I	GGWCC	1 cut(s)	193
BmgT120I	GGNCC	1 cut(s)	193
BmiI	GGNNCC	2 cut(s)	69, 194
BpiI	GAAGAC	1 cut(s)	560
Bpu1102I	GCTNAGC	1 cut(s)	535
BpuEI	CTTGAG	2 cut(s)	368, 539
BsaJI	CCNNGG	1 cut(s)	581
BseDI	CCNNGG	1 cut(s)	581
BseGI	GGATG	1 cut(s)	268
BseMII	CTCAG	3 cut(s)	6, 72, 549
BseXI	GCAGC	1 cut(s)	526
BslFI	GGGAC	2 cut(s)	206, 508
BsmAI	GTCTC	1 cut(s)	117
BsmFI	GGGAC	2 cut(s)	206, 508
Bsp143I	GATC	1 cut(s)	148
Bsp1720I	GCTNAGC	1 cut(s)	535
Bsp19I	CCATGG	1 cut(s)	581
BspCNI	CTCAG	3 cut(s)	7, 71, 548
BspHI	TCATGA	1 cut(s)	151
BspLI	GGNNCC	2 cut(s)	69, 194
BspQI	GCTCTTC	1 cut(s)	15
BssECI	CCNNGG	1 cut(s)	581
BssMI	GATC	1 cut(s)	148
BssT1I	CCWWGG	1 cut(s)	581
Bst6I	CTCTTC	1 cut(s)	15
BstC8I	GCNNGC	1 cut(s)	435
BstDEI	CTNAG	4 cut(s)	15, 58, 219, 535
BstDSI	CCRYGG	1 cut(s)	581
BstF5I	GGATG	1 cut(s)	268
BstKTI	GATC	1 cut(s)	151
BstMAI	GTCTC	1 cut(s)	117
BstMBI	GATC	1 cut(s)	148
BstNSI	RCATGY	1 cut(s)	604
BstSFI	CTRYAG	1 cut(s)	122
BstV1I	GCAGC	1 cut(s)	526
BstV2I	GAAGAC	1 cut(s)	560
BstXI	CCANNNNNNTGG	1 cut(s)	658
BtgI	CCRYGG	1 cut(s)	581
BtsCI	GGATG	1 cut(s)	268
BtsIMutI	CAGTG	1 cut(s)	12
Cac8I	GCNNGC	1 cut(s)	435
CciI	TCATGA	1 cut(s)	151
Cfr13I	GGNCC	1 cut(s)	193
CspCI	CAANNNNNGTGG	2 cut(s)	593, 628
CviAII	CATG	7 cut(s)	152, 294, 409, 572, 582, 601, 658
CviJI	RGCY	9 cut(s)	25, 275, 433, 453, 463, 508, 539, 593, 616
CviKI_1	RGCY	9 cut(s)	25, 275, 433, 453, 463, 508, 539, 593, 616
DdeI	CTNAG	4 cut(s)	15, 58, 219, 535
DpnI	GATC	1 cut(s)	150
DpnII	GATC	1 cut(s)	148
Eam1104I	CTCTTC	1 cut(s)	15
EarI	CTCTTC	1 cut(s)	15
Eco130I	CCWWGG	1 cut(s)	581
Eco47I	GGWCC	1 cut(s)	193
Eco57I	CTGAAG	2 cut(s)	248, 519
EcoO109I	RGGNCCY	1 cut(s)	193
EcoT14I	CCWWGG	1 cut(s)	581
ErhI	CCWWGG	1 cut(s)	581
FaeI	CATG	7 cut(s)	155, 297, 412, 575, 585, 604, 661
FalI	AAGNNNNNCTT	4 cut(s)	264, 296, 492, 524
FaqI	GGGAC	2 cut(s)	206, 508
FatI	CATG	7 cut(s)	151, 293, 408, 571, 581, 600, 657
Fnu4HI	GCNGC	1 cut(s)	540
FokI	GGATG	1 cut(s)	275
Fsp4HI	GCNGC	1 cut(s)	540
FspBI	CTAG	3 cut(s)	26, 197, 688
GluI	GCNGC	1 cut(s)	540
Hin1II	CATG	7 cut(s)	155, 297, 412, 575, 585, 604, 661
HindIII	AAGCTT	1 cut(s)	506
HinfI	GANTC	5 cut(s)	53, 62, 74, 208, 223
HphI	GGTGA	5 cut(s)	49, 376, 400, 438, 639
Hpy166II	GTNNAC	1 cut(s)	406
Hpy188I	TCNGA	2 cut(s)	61, 228
Hpy188III	TCNNGA	3 cut(s)	71, 152, 556
Hpy8I	GTNNAC	1 cut(s)	406
HpyAV	CCTTC	2 cut(s)	133, 361
HpyCH4V	TGCA	5 cut(s)	437, 542, 604, 630, 685
HpyF3I	CTNAG	4 cut(s)	15, 58, 219, 535
Hsp92II	CATG	7 cut(s)	155, 297, 412, 575, 585, 604, 661
Kzo9I	GATC	1 cut(s)	148
LguI	GCTCTTC	1 cut(s)	15
LpnPI	CCDG	4 cut(s)	84, 110, 492, 512
Lsp1109I	GCAGC	1 cut(s)	526
MaeI	CTAG	3 cut(s)	26, 197, 688
MaeIII	GTNAC	4 cut(s)	10, 37, 388, 420
MalI	GATC	1 cut(s)	150
MboI	GATC	1 cut(s)	148
MboII	GAAGA	6 cut(s)	32, 75, 241, 294, 512, 560
MluCI	AATT	5 cut(s)	180, 329, 376, 425, 662
MlyI	GAGTC	2 cut(s)	68, 71
MnlI	CCTC	6 cut(s)	10, 67, 108, 183, 286, 588
MseI	TTAA	2 cut(s)	309, 398
MslI	CAYNNNNRTG	3 cut(s)	156, 599, 656
MspA1I	CMGCKG	1 cut(s)	539
NcoI	CCATGG	1 cut(s)	581
NdeII	GATC	1 cut(s)	148
NlaIII	CATG	7 cut(s)	155, 297, 412, 575, 585, 604, 661
NlaIV	GGNNCC	2 cut(s)	69, 194
NmuCI	GTSAC	4 cut(s)	10, 37, 388, 420
NspI	RCATGY	1 cut(s)	604
PagI	TCATGA	1 cut(s)	151
PciSI	GCTCTTC	1 cut(s)	15
PfeI	GAWTC	3 cut(s)	53, 208, 223
PkrI	GCNGC	1 cut(s)	541
PleI	GAGTC	2 cut(s)	68, 70
PpsI	GAGTC	2 cut(s)	68, 70
PpuMI	RGGWCCY	1 cut(s)	193
Psp5II	RGGWCCY	1 cut(s)	193
PspN4I	GGNNCC	2 cut(s)	69, 194
PspPI	GGNCC	1 cut(s)	193
PspPPI	RGGWCCY	1 cut(s)	193
PvuII	CAGCTG	1 cut(s)	539
RseI	CAYNNNNRTG	3 cut(s)	156, 599, 656
SapI	GCTCTTC	1 cut(s)	15
SaqAI	TTAA	2 cut(s)	309, 398
SatI	GCNGC	1 cut(s)	540
Sau3AI	GATC	1 cut(s)	148
Sau96I	GGNCC	1 cut(s)	193
SchI	GAGTC	2 cut(s)	68, 71
SfcI	CTRYAG	1 cut(s)	122
SinI	GGWCC	1 cut(s)	193
SmiMI	CAYNNNNRTG	3 cut(s)	156, 599, 656
SmlI	CTYRAG	2 cut(s)	383, 554
SmoI	CTYRAG	2 cut(s)	383, 554
Sse9I	AATT	5 cut(s)	180, 329, 376, 425, 662
SspMI	CTAG	3 cut(s)	26, 197, 688
StyI	CCWWGG	1 cut(s)	581
TasI	AATT	5 cut(s)	180, 329, 376, 425, 662
TfiI	GAWTC	3 cut(s)	53, 208, 223
Tru1I	TTAA	2 cut(s)	309, 398
Tru9I	TTAA	2 cut(s)	309, 398
TscAI	CASTG	1 cut(s)	19
TseFI	GTSAC	4 cut(s)	10, 37, 388, 420
TseI	GCWGC	1 cut(s)	539
Tsp45I	GTSAC	4 cut(s)	10, 37, 388, 420
TspDTI	ATGAA	8 cut(s)	37, 200, 263, 282, 285, 342, 360, 560
TspRI	CASTG	1 cut(s)	19
VpaK11BI	GGWCC	1 cut(s)	193
XapI	RAATTY	1 cut(s)	329
XceI	RCATGY	1 cut(s)	604
XspI	CTAG	3 cut(s)	26, 197, 688

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.