Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000211.1

Orthogroup ID

OG0014859

Physical Location & Seq

Genomic Coordinates Reverse (-)

2387 .. 4745

Gene Structure 2359 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1329 bp

atgtttgcaccttgggagttagatagctatgatgacgaaatagaccaccaactatgcatgggccatgtctttgatgatttagaagatgggccagaagtaatgatgaatgaacagcaatcagttgttcaggatggaccaattcaagttgatgagctgcacaaagaagccaaacagaggcctaaacataaagggaagcaaaagatggttgttgaagacagtgaagttccaaagaagaagaaaggcagacctaagaaagagctgaaaaggaggtatgacacaagattcaaatgggagtgcacctatgctcaagaaaacttatatgatgatgatgatgaatctgatagtacatcaagctcaaaagatctggactatgacgctatagtcgacaatgattatgaaatttttgatgaagatgatgaggtactttttcaaacaaacatggatggtgatctaagcaagcctgaagagtgggaagagatggggttttctggtcatatttttgatggtgatggagacaactcatatgaccttcatagtttaaatggtgatttagatgagaatggtgaagatgttgggagatttaaagttaagggaaagaggaggtggtctaaatggaaggagttcaacaagatgtttgacatgaagaggccaagttttgaactcggaatggcatttcctaattttgtagtgttcaaggaagcaacacggaagcatgctgtattgactaaaaaagagcttcgttttgcaagtcctgataaaaatactccaactatgaacattaggactttgaggatggagcacaagtgtagtgaactcaaaggtagggtatatcactgtcatgcccctttcattgcttctgagtacagtgcaagcttcacaaatgatgagaaatggtcaagagagggtccaagggttgagaagttgttgaaaaagaatgcagattggagccaagaatatagagcattggagtctaataatatgaggtttgagatacatggcagaggtgttacttgtagttcaggtgttatttctcattatgttgtgcaattggacaacatggcatgtacatgtaaaagatgcgattttagtggacttccctgtggacatgctatcgcagcaatttacttcaagggatggtccgctaatgactttgttgatgagcaccataaacaaaagaagtatttgatggcttatgaaccaatgatcaaccctatagctggggtcgatgagtgggagttgattaacaggccaattgcacctccaaggtttagaagactaatcggaaggccgaaaatgtcgagaaacaaacaactaggtaaagcatactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00592 ko01110 map00592 map01110

Pfam Domains

Protein Families

Methyltransf_7

Protein Analysis

442

Amino Acids

51.53

Weight (kDa)

5.69

Isoelectric Point (pI)

51.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014859)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0303401
rosa_laevigata	RLG00000009556 RLG00000019103 RLG00000023233
rosa_multiflora	Rmu_sc0000211.1_g000002 Rmu_sc0000250.1_g000012
rosa_roxburghii	Rroxscaffold_3G00252420 Rroxscaffold_5G00341090
rosa_rugosa	Rorug01G0086700 Rorug01G0086900 Rorug03G0350800
rosa_samantha	Rh1AG415700 Rh3DG110600 Rh4BG066000 Rh4CG072600 Rh4DG062900 Rh4DG429700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	380
AccI	GTMKAC	1 cut(s)	384
AciI	CCGC	1 cut(s)	1140
AcsI	RAATTY	1 cut(s)	399
AcuI	CTGAAG	1 cut(s)	483
AfaI	GTAC	4 cut(s)	346, 423, 863, 1066
AfiI	CCNNNNNNNGG	2 cut(s)	174, 1217
AflIII	ACRYGT	1 cut(s)	1067
AgsI	TTSAA	9 cut(s)	143, 212, 286, 431, 625, 659, 694, 928, 1129
AluBI	AGCT	7 cut(s)	27, 154, 259, 354, 736, 873, 1217
AluI	AGCT	7 cut(s)	27, 154, 259, 354, 736, 873, 1217
Alw21I	GWGCWC	3 cut(s)	299, 801, 1164
Alw26I	GTCTC	1 cut(s)	507
Alw44I	GTGCAC	1 cut(s)	295
AoxI	GGCC	6 cut(s)	61, 89, 176, 647, 1247, 1286
ApaLI	GTGCAC	1 cut(s)	295
ApeKI	GCWGC	2 cut(s)	154, 1115
ApoI	RAATTY	1 cut(s)	399
Asp700I	GAANNNNTTC	1 cut(s)	620
AspS9I	GGNCC	5 cut(s)	61, 89, 134, 905, 1137
AsuHPI	GGTGA	4 cut(s)	458, 518, 557, 575
AvaII	GGWCC	3 cut(s)	134, 905, 1137
BaeGI	GKGCMC	1 cut(s)	299
BbsI	GAAGAC	2 cut(s)	219, 1279
Bbv12I	GWGCWC	3 cut(s)	299, 801, 1164
BbvI	GCAGC	2 cut(s)	141, 1127
BclI	TGATCA	1 cut(s)	1203
BcoDI	GTCTC	1 cut(s)	507
BfaI	CTAG	1 cut(s)	1313
BfmI	CTRYAG	2 cut(s)	378, 1212
BglII	AGATCT	1 cut(s)	361
BisI	GCNGC	2 cut(s)	155, 1116
BlsI	GCNGC	2 cut(s)	156, 1117
Bme18I	GGWCC	3 cut(s)	134, 905, 1137
BmgT120I	GGNCC	5 cut(s)	61, 89, 134, 905, 1137
BmiI	GGNNCC	2 cut(s)	906, 947
BmsI	GCATC	1 cut(s)	1067
BpiI	GAAGAC	2 cut(s)	219, 1279
BpuEI	CTTGAG	1 cut(s)	291
BsaBI	GATNNNNATC	1 cut(s)	447
BsaJI	CCNNGG	3 cut(s)	11, 908, 1262
BsaXI	ACNNNNNCTCC	2 cut(s)	788, 818
Bsc4I	CCNNNNNNNGG	2 cut(s)	174, 1217
Bse3DI	GCAATG	1 cut(s)	849
Bse8I	GATNNNNATC	1 cut(s)	447
BseDI	CCNNGG	3 cut(s)	11, 908, 1262
BseGI	GGATG	4 cut(s)	136, 448, 798, 1139
BseJI	GATNNNNATC	1 cut(s)	447
BseLI	CCNNNNNNNGG	2 cut(s)	174, 1217
BseMI	GCAATG	1 cut(s)	849
BseMII	CTCAG	1 cut(s)	849
BseRI	GAGGAG	1 cut(s)	613
BseSI	GKGCMC	1 cut(s)	299
BseXI	GCAGC	2 cut(s)	141, 1127
BseYI	CCCAGC	1 cut(s)	1217
BsgI	GTGCAG	1 cut(s)	140
BshFI	GGCC	6 cut(s)	63, 91, 178, 649, 1249, 1288
BsiHKAI	GWGCWC	3 cut(s)	299, 801, 1164
BslI	CCNNNNNNNGG	2 cut(s)	174, 1217
BsmAI	GTCTC	1 cut(s)	507
BsmI	GAATGC	1 cut(s)	940
BsnI	GGCC	6 cut(s)	63, 91, 178, 649, 1249, 1288
Bsp1286I	GDGCHC	3 cut(s)	299, 801, 1164
Bsp1407I	TGTACA	1 cut(s)	1064
Bsp143I	GATC	3 cut(s)	361, 448, 1203
BspACI	CCGC	1 cut(s)	1140
BspANI	GGCC	6 cut(s)	63, 91, 178, 649, 1249, 1288
BspCNI	CTCAG	1 cut(s)	850
BspLI	GGNNCC	2 cut(s)	906, 947
BsrDI	GCAATG	1 cut(s)	849
BsrGI	TGTACA	1 cut(s)	1064
BssECI	CCNNGG	3 cut(s)	11, 908, 1262
BssMI	GATC	3 cut(s)	361, 448, 1203
BssT1I	CCWWGG	3 cut(s)	11, 908, 1262
Bst4CI	ACNGT	3 cut(s)	218, 836, 866
Bst6I	CTCTTC	3 cut(s)	459, 468, 638
BstAUI	TGTACA	1 cut(s)	1064
BstC8I	GCNNGC	3 cut(s)	458, 714, 871
BstDEI	CTNAG	3 cut(s)	249, 452, 858
BstF5I	GGATG	4 cut(s)	136, 448, 798, 1139
BstKTI	GATC	3 cut(s)	364, 451, 1206
BstMAI	GTCTC	1 cut(s)	507
BstMBI	GATC	3 cut(s)	361, 448, 1203
BstMWI	GCNNNNNNNGC	1 cut(s)	1115
BstNSI	RCATGY	4 cut(s)	716, 1065, 1071, 1109
BstSFI	CTRYAG	2 cut(s)	378, 1212
BstSLI	GKGCMC	1 cut(s)	299
BstV1I	GCAGC	2 cut(s)	141, 1127
BstV2I	GAAGAC	2 cut(s)	219, 1279
BstX2I	RGATCY	1 cut(s)	361
BstYI	RGATCY	1 cut(s)	361
BsuRI	GGCC	6 cut(s)	63, 91, 178, 649, 1249, 1288
BtsCI	GGATG	4 cut(s)	136, 448, 798, 1139
BtsIMutI	CAGTG	3 cut(s)	223, 832, 871
Cac8I	GCNNGC	3 cut(s)	458, 714, 871
Cfr13I	GGNCC	5 cut(s)	61, 89, 134, 905, 1137
CseI	GACGC	1 cut(s)	383
Csp6I	GTAC	4 cut(s)	345, 422, 862, 1065
CviQI	GTAC	4 cut(s)	345, 422, 862, 1065
DdeI	CTNAG	3 cut(s)	249, 452, 858
DpnI	GATC	3 cut(s)	363, 450, 1205
DpnII	GATC	3 cut(s)	361, 448, 1203
DraI	TTTAAA	2 cut(s)	540, 583
DrdI	GACNNNNNNGTC	1 cut(s)	380
DseDI	GACNNNNNNGTC	1 cut(s)	380
Eam1104I	CTCTTC	3 cut(s)	459, 468, 638
EarI	CTCTTC	3 cut(s)	459, 468, 638
Eco130I	CCWWGG	3 cut(s)	11, 908, 1262
Eco147I	AGGCCT	1 cut(s)	178
Eco47I	GGWCC	3 cut(s)	134, 905, 1137
Eco57I	CTGAAG	1 cut(s)	483
EcoT14I	CCWWGG	3 cut(s)	11, 908, 1262
EcoT22I	ATGCAT	1 cut(s)	59
ErhI	CCWWGG	3 cut(s)	11, 908, 1262
FauNDI	CATATG	1 cut(s)	523
FbaI	TGATCA	1 cut(s)	1203
FblI	GTMKAC	1 cut(s)	384
Fnu4HI	GCNGC	2 cut(s)	155, 1116
FokI	GGATG	4 cut(s)	143, 455, 805, 1146
Fsp4HI	GCNGC	2 cut(s)	155, 1116
FspBI	CTAG	1 cut(s)	1313
GluI	GCNGC	2 cut(s)	155, 1116
GsaI	CCCAGC	1 cut(s)	1221
HaeIII	GGCC	6 cut(s)	63, 91, 178, 649, 1249, 1288
HgaI	GACGC	1 cut(s)	383
HincII	GTYRAC	1 cut(s)	385
HindII	GTYRAC	1 cut(s)	385
HindIII	AAGCTT	1 cut(s)	871
HinfI	GANTC	3 cut(s)	282, 335, 968
HphI	GGTGA	4 cut(s)	458, 518, 557, 575
Hpy166II	GTNNAC	5 cut(s)	297, 385, 812, 1091, 1103
Hpy188I	TCNGA	4 cut(s)	340, 665, 859, 1283
Hpy188III	TCNNGA	6 cut(s)	128, 308, 365, 752, 897, 1299
Hpy8I	GTNNAC	5 cut(s)	297, 385, 812, 1091, 1103
HpyAV	CCTTC	3 cut(s)	539, 610, 1278
HpyCH4III	ACNGT	3 cut(s)	218, 836, 866
HpyCH4V	TGCA	9 cut(s)	8, 57, 157, 297, 746, 869, 938, 1045, 1256
HpyF10VI	GCNNNNNNNGC	1 cut(s)	1115
HpyF3I	CTNAG	3 cut(s)	249, 452, 858
Ksp22I	TGATCA	1 cut(s)	1203
Kzo9I	GATC	3 cut(s)	361, 448, 1203
LmnI	GCTCC	2 cut(s)	796, 945
Lsp1109I	GCAGC	2 cut(s)	141, 1127
LweI	GCATC	1 cut(s)	1067
MaeI	CTAG	1 cut(s)	1313
MaeIII	GTNAC	1 cut(s)	1006
MalI	GATC	3 cut(s)	363, 450, 1205
MboI	GATC	3 cut(s)	361, 448, 1203
MfeI	CAATTG	2 cut(s)	1046, 1251
MflI	RGATCY	1 cut(s)	361
MhlI	GDGCHC	3 cut(s)	299, 801, 1164
MluCI	AATT	6 cut(s)	138, 399, 679, 1046, 1119, 1251
MlyI	GAGTC	1 cut(s)	977
MmeI	TCCRAC	1 cut(s)	791
Mph1103I	ATGCAT	1 cut(s)	59
MroXI	GAANNNNTTC	1 cut(s)	620
MseI	TTAA	4 cut(s)	539, 582, 588, 1242
MslI	CAYNNNNRTG	2 cut(s)	837, 1066
MunI	CAATTG	2 cut(s)	1046, 1251
Mva1269I	GAATGC	1 cut(s)	940
MwoI	GCNNNNNNNGC	1 cut(s)	1115
NdeI	CATATG	1 cut(s)	523
NdeII	GATC	3 cut(s)	361, 448, 1203
NlaIV	GGNNCC	2 cut(s)	906, 947
NsiI	ATGCAT	1 cut(s)	59
NspI	RCATGY	4 cut(s)	716, 1065, 1071, 1109
PaeI	GCATGC	1 cut(s)	716
PceI	AGGCCT	1 cut(s)	178
PciI	ACATGT	1 cut(s)	1067
PcsI	WCGNNNNNNNCGW	1 cut(s)	381
PctI	GAATGC	1 cut(s)	940
PdmI	GAANNNNTTC	1 cut(s)	620
PfeI	GAWTC	2 cut(s)	282, 335
PkrI	GCNGC	2 cut(s)	156, 1117
PleI	GAGTC	1 cut(s)	976
PpsI	GAGTC	1 cut(s)	976
PscI	ACATGT	1 cut(s)	1067
PspFI	CCCAGC	1 cut(s)	1217
PspN4I	GGNNCC	2 cut(s)	906, 947
PspPI	GGNCC	5 cut(s)	61, 89, 134, 905, 1137
PsuI	RGATCY	1 cut(s)	361
RsaI	GTAC	4 cut(s)	346, 423, 863, 1066
RsaNI	GTAC	4 cut(s)	345, 422, 862, 1065
RseI	CAYNNNNRTG	2 cut(s)	837, 1066
SalI	GTCGAC	1 cut(s)	383
SaqAI	TTAA	4 cut(s)	539, 582, 588, 1242
SatI	GCNGC	2 cut(s)	155, 1116
Sau3AI	GATC	3 cut(s)	361, 448, 1203
Sau96I	GGNCC	5 cut(s)	61, 89, 134, 905, 1137
SchI	GAGTC	1 cut(s)	977
SduI	GDGCHC	3 cut(s)	299, 801, 1164
SfaNI	GCATC	1 cut(s)	1067
SfcI	CTRYAG	2 cut(s)	378, 1212
SinI	GGWCC	3 cut(s)	134, 905, 1137
SmiMI	CAYNNNNRTG	2 cut(s)	837, 1066
SmlI	CTYRAG	1 cut(s)	306
SmoI	CTYRAG	1 cut(s)	306
SphI	GCATGC	1 cut(s)	716
Sse9I	AATT	6 cut(s)	138, 399, 679, 1046, 1119, 1251
SseBI	AGGCCT	1 cut(s)	178
SsiI	CCGC	1 cut(s)	1140
SspMI	CTAG	1 cut(s)	1313
StuI	AGGCCT	1 cut(s)	178
StyI	CCWWGG	3 cut(s)	11, 908, 1262
TaaI	ACNGT	3 cut(s)	218, 836, 866
TaqI	TCGA	3 cut(s)	384, 1224, 1298
TasI	AATT	6 cut(s)	138, 399, 679, 1046, 1119, 1251
TatI	WGTACW	3 cut(s)	344, 861, 1064
TfiI	GAWTC	2 cut(s)	282, 335
Tru1I	TTAA	4 cut(s)	539, 582, 588, 1242
Tru9I	TTAA	4 cut(s)	539, 582, 588, 1242
TscAI	CASTG	3 cut(s)	223, 839, 871
TseI	GCWGC	2 cut(s)	154, 1115
TspGWI	ACGGA	1 cut(s)	721
TspRI	CASTG	3 cut(s)	223, 839, 871
VneI	GTGCAC	1 cut(s)	295
VpaK11BI	GGWCC	3 cut(s)	134, 905, 1137
XapI	RAATTY	1 cut(s)	399
XceI	RCATGY	4 cut(s)	716, 1065, 1071, 1109
XmiI	GTMKAC	1 cut(s)	384
XmnI	GAANNNNTTC	1 cut(s)	620
XspI	CTAG	1 cut(s)	1313
Zsp2I	ATGCAT	1 cut(s)	59

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.