Rh4DG062900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0014859
Physical Location & Seq
Reverse (-)
9400749 .. 9401676
928 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG062900.1

Sequence Viewer

Length: 570 bp
ATGCAGCCCCGAAACCCAAATGTGAGAGATGAAATTCCATCTGACAATATGGAAACCTCAAATGTGAGAGCTGAAATCCCAAGTCAGCGTACTGGAGCCCCACCTAAGAACTTGGGGATGAATGTCAATGTGAACTTAAATTTGAATGTGAATGGGGGAAGTGATAATGTGATAAATGTTCCAATTGATCCTTTGCCATATTTGATTGTCCAAGTCCCCACTATTAATGCTGCAGATGATAATTTGCAGAATCTGCAAATGCAAAATGGGAATTTGATAAATGTTCCAATTGATCCTTTGCCATCTTTGACTGTCCAAGTTCCCTCCATGTGTGTTAATGCTGGAGATGATAATTTGCAGAATCTGCAAATGCAAAATGGGAATTTGGTTGAATCAAATCAGTTGTTGAAGGTACATGTAAAACCAATCTCAATATCTACAGCCAAGTCTACCACTAAAATTGGTGAATCAAGAAGGTTGAAGACACTTGCAAATAGGATTAAAATCATTAAACCCTTTAACAAACCAGGAGCAACTAACATTGGCACAAGCAAAAAGAATGAAGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

189

Amino Acids

20.56

Weight (kDa)

8.76

Isoelectric Point (pI)

30.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 449
AclWI GGATC 2 cut(s) 182, 287
AcsI RAATTY 4 cut(s) 33, 139, 271, 382
AfaI GTAC 2 cut(s) 91, 414
AflIII ACRYGT 1 cut(s) 415
AgsI TTSAA 4 cut(s) 145, 392, 409, 481
AjnI CCWGG 1 cut(s) 526
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
AlwI GGATC 2 cut(s) 182, 287
AlwNI CAGNNNCTG 2 cut(s) 253, 364
ApeKI GCWGC 2 cut(s) 4, 230
ApoI RAATTY 4 cut(s) 33, 139, 271, 382
AseI ATTAAT 1 cut(s) 225
AsuHPI GGTGA 1 cut(s) 476
BanII GRGCYC 1 cut(s) 100
BbsI GAAGAC 1 cut(s) 488
BbvI GCAGC 2 cut(s) 16, 217
BccI CCATC 2 cut(s) 46, 310
BciT130I CCWGG 1 cut(s) 528
BfmI CTRYAG 2 cut(s) 231, 438
BisI GCNGC 2 cut(s) 5, 231
BlsI GCNGC 2 cut(s) 6, 232
Bme1390I CCNGG 1 cut(s) 528
BmiI GGNNCC 1 cut(s) 97
BmrFI CCNGG 1 cut(s) 528
BpiI GAAGAC 1 cut(s) 488
BpmI CTGGAG 2 cut(s) 114, 363
BsaBI GATNNNNATC 1 cut(s) 503
Bse1I ACTGG 1 cut(s) 97
Bse8I GATNNNNATC 1 cut(s) 503
BseBI CCWGG 1 cut(s) 528
BseGI GGATG 1 cut(s) 123
BseJI GATNNNNATC 1 cut(s) 503
BseNI ACTGG 1 cut(s) 97
BseXI GCAGC 2 cut(s) 16, 217
BslFI GGGAC 1 cut(s) 200
BsmFI GGGAC 1 cut(s) 200
Bsp1286I GDGCHC 1 cut(s) 100
Bsp143I GATC 2 cut(s) 187, 292
BspLI GGNNCC 1 cut(s) 97
BspMAI CTGCAG 1 cut(s) 235
BspPI GGATC 2 cut(s) 182, 287
BsrI ACTGG 1 cut(s) 97
BssMI GATC 2 cut(s) 187, 292
Bst2UI CCWGG 1 cut(s) 528
Bst4CI ACNGT 1 cut(s) 313
BstAPI GCANNNNNTGC 2 cut(s) 253, 364
BstDEI CTNAG 1 cut(s) 105
BstF5I GGATG 1 cut(s) 123
BstKTI GATC 2 cut(s) 190, 295
BstMBI GATC 2 cut(s) 187, 292
BstMWI GCNNNNNNNGC 2 cut(s) 253, 364
BstNI CCWGG 1 cut(s) 528
BstNSI RCATGY 1 cut(s) 419
BstSCI CCNGG 1 cut(s) 526
BstSFI CTRYAG 2 cut(s) 231, 438
BstV1I GCAGC 2 cut(s) 16, 217
BstV2I GAAGAC 1 cut(s) 488
BtsCI GGATG 1 cut(s) 123
CaiI CAGNNNCTG 2 cut(s) 253, 364
Csp6I GTAC 2 cut(s) 90, 413
CspCI CAANNNNNGTGG 2 cut(s) 442, 477
CviAII CATG 2 cut(s) 328, 416
CviJI RGCY 4 cut(s) 7, 71, 98, 443
CviKI_1 RGCY 4 cut(s) 7, 71, 98, 443
CviQI GTAC 2 cut(s) 90, 413
DdeI CTNAG 1 cut(s) 105
DpnI GATC 2 cut(s) 189, 294
DpnII GATC 2 cut(s) 187, 292
Eco24I GRGCYC 1 cut(s) 100
EcoRII CCWGG 1 cut(s) 526
EcoT38I GRGCYC 1 cut(s) 100
FaeI CATG 2 cut(s) 331, 419
FaiI YATR 4 cut(s) 50, 199, 329, 417
FaqI GGGAC 1 cut(s) 200
FatI CATG 2 cut(s) 327, 415
FblI GTMKAC 1 cut(s) 449
Fnu4HI GCNGC 2 cut(s) 5, 231
FokI GGATG 1 cut(s) 130
FriOI GRGCYC 1 cut(s) 100
Fsp4HI GCNGC 2 cut(s) 5, 231
GluI GCNGC 2 cut(s) 5, 231
GsuI CTGGAG 2 cut(s) 114, 363
Hin1II CATG 2 cut(s) 331, 419
HinfI GANTC 4 cut(s) 250, 361, 392, 467
HphI GGTGA 1 cut(s) 476
Hpy166II GTNNAC 2 cut(s) 133, 450
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 1 cut(s) 471
Hpy8I GTNNAC 2 cut(s) 133, 450
HpyAV CCTTC 2 cut(s) 403, 468
HpyCH4III ACNGT 1 cut(s) 313
HpyCH4V TGCA 9 cut(s) 4, 233, 247, 256, 262, 358, 367, 373, 491
HpyF10VI GCNNNNNNNGC 2 cut(s) 253, 364
HpyF3I CTNAG 1 cut(s) 105
Hsp92II CATG 2 cut(s) 331, 419
Kzo9I GATC 2 cut(s) 187, 292
LmnI GCTCC 2 cut(s) 95, 530
LpnPI CCDG 4 cut(s) 78, 327, 513, 540
Lsp1109I GCAGC 2 cut(s) 16, 217
MalI GATC 2 cut(s) 189, 294
MboI GATC 2 cut(s) 187, 292
MboII GAAGA 1 cut(s) 493
MfeI CAATTG 2 cut(s) 183, 288
MhlI GDGCHC 1 cut(s) 100
MluCI AATT 9 cut(s) 33, 139, 183, 241, 271, 288, 352, 382, 459
MnlI CCTC 2 cut(s) 67, 334
MseI TTAA 6 cut(s) 137, 225, 336, 501, 510, 519
MspR9I CCNGG 1 cut(s) 528
MunI CAATTG 2 cut(s) 183, 288
MvaI CCWGG 1 cut(s) 528
MwoI GCNNNNNNNGC 2 cut(s) 253, 364
NdeII GATC 2 cut(s) 187, 292
NlaIII CATG 2 cut(s) 331, 419
NlaIV GGNNCC 1 cut(s) 97
NspI RCATGY 1 cut(s) 419
PciI ACATGT 1 cut(s) 415
PfeI GAWTC 4 cut(s) 250, 361, 392, 467
PkrI GCNGC 2 cut(s) 6, 232
PscI ACATGT 1 cut(s) 415
PshBI ATTAAT 1 cut(s) 225
Psp6I CCWGG 1 cut(s) 526
PspGI CCWGG 1 cut(s) 526
PspN4I GGNNCC 1 cut(s) 97
PstI CTGCAG 1 cut(s) 235
PstNI CAGNNNCTG 2 cut(s) 253, 364
RsaI GTAC 2 cut(s) 91, 414
RsaNI GTAC 2 cut(s) 90, 413
SaqAI TTAA 6 cut(s) 137, 225, 336, 501, 510, 519
SatI GCNGC 2 cut(s) 5, 231
Sau3AI GATC 2 cut(s) 187, 292
ScrFI CCNGG 1 cut(s) 528
SduI GDGCHC 1 cut(s) 100
SetI ASST 5 cut(s) 59, 73, 106, 414, 479
SfcI CTRYAG 2 cut(s) 231, 438
Sse9I AATT 9 cut(s) 33, 139, 183, 241, 271, 288, 352, 382, 459
StyD4I CCNGG 1 cut(s) 526
TaaI ACNGT 1 cut(s) 313
TasI AATT 9 cut(s) 33, 139, 183, 241, 271, 288, 352, 382, 459
TfiI GAWTC 4 cut(s) 250, 361, 392, 467
Tru1I TTAA 6 cut(s) 137, 225, 336, 501, 510, 519
Tru9I TTAA 6 cut(s) 137, 225, 336, 501, 510, 519
TseI GCWGC 2 cut(s) 4, 230
TspDTI ATGAA 2 cut(s) 45, 134
VspI ATTAAT 1 cut(s) 225
XapI RAATTY 4 cut(s) 33, 139, 271, 382
XceI RCATGY 1 cut(s) 419
XmiI GTMKAC 1 cut(s) 449
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.