Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000368.1

Orthogroup ID

OG0017790

Physical Location & Seq

Genomic Coordinates Forward (+)

135790 .. 138685

Gene Structure 2896 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000368.1_g000029.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 627 bp

atggaagggaaaaggacaagttggatgagaaggaaggaaagagacaggagtctgggtggagaggaacaaaagtattttgttggggtttttgagaagtattttgctaagatcagggagtttgccttcccgcctccagcacaggctattgatcttggctctggggagtctaaagaagctattttccaggccactccaggtttttcatcagacttctcttatatttgtgccatgggagtggtcgctttgttgtctggccaaccaaaagaaggtgtcttgatcgaggccagatcagaatcaaaaggcttctacgaggaaagagtgaccgactcatctggaagttatcgtttgagaggacttgttcctgacacaacctatgtaatcaaagtagtaaaaagggatggtttgggcagcagtaaaattgagagggcatcaccagactcggttccagttaaggaggctcttttcgcacttagagcaagagattttctcacttggagagttggaattggatttgcagcaaagtatttaaggtatgaatttgatttcctcgatcttgctaatgaattcgatgttttgaatgatgaatatcttgaatttgatgctttgaatttgatttctatggtctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CarboxypepD_reg

Protein Analysis

208

Amino Acids

23.48

Weight (kDa)

5.31

Isoelectric Point (pI)

41.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017790)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0134311 RchiOBHm_Chr5g0064851 RchiOBHm_Chr7g0217491
rosa_multiflora	Rmu_sc0000368.1_g000029
rosa_roxburghii	Rroxscaffold_2G00108920 Rroxscaffold_4G00278930 Rroxscaffold_5G00368450 Rroxscaffold_6G00389850
rosa_rugosa	Rorug03G0029500
rosa_samantha	Rh3DG316600 Rh3DG316800
rosa_wichuraiana	Rw3G025100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	128
AcoI	YGGCCR	1 cut(s)	253
AcsI	RAATTY	4 cut(s)	536, 563, 593, 607
AfiI	CCNNNNNNNGG	1 cut(s)	266
AgsI	TTSAA	3 cut(s)	577, 593, 607
AjnI	CCWGG	2 cut(s)	183, 193
AluBI	AGCT	1 cut(s)	176
AluI	AGCT	1 cut(s)	176
Alw26I	GTCTC	1 cut(s)	36
AoxI	GGCC	3 cut(s)	186, 253, 282
ApeKI	GCWGC	2 cut(s)	408, 515
ApoI	RAATTY	4 cut(s)	536, 563, 593, 607
AsuHPI	GGTGA	1 cut(s)	423
BalI	TGGCCA	1 cut(s)	255
BbvI	GCAGC	2 cut(s)	420, 527
BccI	CCATC	1 cut(s)	392
BciT130I	CCWGG	2 cut(s)	185, 195
BcoDI	GTCTC	1 cut(s)	36
BisI	GCNGC	2 cut(s)	409, 516
BlsI	GCNGC	2 cut(s)	410, 517
Bme1390I	CCNGG	2 cut(s)	185, 195
BmiI	GGNNCC	1 cut(s)	444
BmrFI	CCNGG	2 cut(s)	185, 195
BmsI	GCATC	2 cut(s)	437, 589
BoxI	GACNNNNGTC	1 cut(s)	48
BplI	GAGNNNNNCTC	2 cut(s)	471, 503
BpmI	CTGGAG	2 cut(s)	117, 177
BsaBI	GATNNNNATC	2 cut(s)	292, 585
BsaJI	CCNNGG	1 cut(s)	228
BsaXI	ACNNNNNCTCC	2 cut(s)	40, 70
Bsc4I	CCNNNNNNNGG	1 cut(s)	266
Bse1I	ACTGG	1 cut(s)	446
Bse8I	GATNNNNATC	2 cut(s)	292, 585
BseBI	CCWGG	2 cut(s)	185, 195
BseDI	CCNNGG	1 cut(s)	228
BseGI	GGATG	2 cut(s)	30, 403
BseJI	GATNNNNATC	2 cut(s)	292, 585
BseLI	CCNNNNNNNGG	1 cut(s)	266
BseNI	ACTGG	1 cut(s)	446
BseXI	GCAGC	2 cut(s)	420, 527
BshFI	GGCC	3 cut(s)	188, 255, 284
BslI	CCNNNNNNNGG	1 cut(s)	266
BsmAI	GTCTC	1 cut(s)	36
BsnI	GGCC	3 cut(s)	188, 255, 284
Bsp143I	GATC	5 cut(s)	108, 148, 276, 287, 550
Bsp19I	CCATGG	1 cut(s)	228
BspACI	CCGC	1 cut(s)	128
BspANI	GGCC	3 cut(s)	188, 255, 284
BspLI	GGNNCC	1 cut(s)	444
BsrI	ACTGG	1 cut(s)	446
BssECI	CCNNGG	1 cut(s)	228
BssMI	GATC	5 cut(s)	108, 148, 276, 287, 550
BssT1I	CCWWGG	1 cut(s)	228
Bst2UI	CCWGG	2 cut(s)	185, 195
BstDEI	CTNAG	2 cut(s)	105, 470
BstDSI	CCRYGG	1 cut(s)	228
BstF5I	GGATG	2 cut(s)	30, 403
BstKTI	GATC	5 cut(s)	111, 151, 279, 290, 553
BstMAI	GTCTC	1 cut(s)	36
BstMBI	GATC	5 cut(s)	108, 148, 276, 287, 550
BstMWI	GCNNNNNNNGC	2 cut(s)	464, 473
BstNI	CCWGG	2 cut(s)	185, 195
BstPAI	GACNNNNGTC	1 cut(s)	48
BstSCI	CCNGG	2 cut(s)	183, 193
BstV1I	GCAGC	2 cut(s)	420, 527
BstXI	CCANNNNNNTGG	1 cut(s)	235
BsuRI	GGCC	3 cut(s)	188, 255, 284
BtgI	CCRYGG	1 cut(s)	228
BtsCI	GGATG	2 cut(s)	30, 403
CviAII	CATG	1 cut(s)	229
CviJI	RGCY	8 cut(s)	143, 156, 176, 188, 255, 284, 303, 458
CviKI_1	RGCY	8 cut(s)	143, 156, 176, 188, 255, 284, 303, 458
DdeI	CTNAG	2 cut(s)	105, 470
DpnI	GATC	5 cut(s)	110, 150, 278, 289, 552
DpnII	GATC	5 cut(s)	108, 148, 276, 287, 550
EaeI	YGGCCR	1 cut(s)	253
Eco130I	CCWWGG	1 cut(s)	228
EcoRI	GAATTC	1 cut(s)	563
EcoRII	CCWGG	2 cut(s)	183, 193
EcoT14I	CCWWGG	1 cut(s)	228
ErhI	CCWWGG	1 cut(s)	228
FaeI	CATG	1 cut(s)	232
FaiI	YATR	5 cut(s)	219, 230, 375, 534, 620
FatI	CATG	1 cut(s)	228
FauI	CCCGC	1 cut(s)	135
Fnu4HI	GCNGC	2 cut(s)	409, 516
FokI	GGATG	2 cut(s)	37, 410
Fsp4HI	GCNGC	2 cut(s)	409, 516
GluI	GCNGC	2 cut(s)	409, 516
GsuI	CTGGAG	2 cut(s)	117, 177
HaeIII	GGCC	3 cut(s)	188, 255, 284
Hin1II	CATG	1 cut(s)	232
HinfI	GANTC	5 cut(s)	49, 164, 293, 326, 437
HphI	GGTGA	1 cut(s)	423
Hpy188I	TCNGA	3 cut(s)	208, 292, 626
Hpy188III	TCNNGA	4 cut(s)	274, 333, 362, 590
HpyAV	CCTTC	4 cut(s)	24, 28, 133, 260
HpyCH4V	TGCA	1 cut(s)	515
HpyF10VI	GCNNNNNNNGC	2 cut(s)	464, 473
HpyF3I	CTNAG	2 cut(s)	105, 470
Hsp92II	CATG	1 cut(s)	232
Kzo9I	GATC	5 cut(s)	108, 148, 276, 287, 550
Lsp1109I	GCAGC	2 cut(s)	420, 527
LweI	GCATC	2 cut(s)	437, 589
MaeIII	GTNAC	1 cut(s)	319
MalI	GATC	5 cut(s)	110, 150, 278, 289, 552
MboI	GATC	5 cut(s)	108, 148, 276, 287, 550
MlsI	TGGCCA	1 cut(s)	255
MluCI	AATT	6 cut(s)	417, 504, 536, 563, 593, 607
MluNI	TGGCCA	1 cut(s)	255
MlyI	GAGTC	4 cut(s)	58, 173, 320, 431
MmeI	TCCRAC	1 cut(s)	481
MnlI	CCTC	8 cut(s)	55, 141, 274, 304, 344, 417, 448, 557
Mox20I	TGGCCA	1 cut(s)	255
MscI	TGGCCA	1 cut(s)	255
MseI	TTAA	2 cut(s)	450, 527
MslI	CAYNNNNRTG	1 cut(s)	233
Msp20I	TGGCCA	1 cut(s)	255
MspR9I	CCNGG	2 cut(s)	185, 195
MvaI	CCWGG	2 cut(s)	185, 195
MwoI	GCNNNNNNNGC	2 cut(s)	464, 473
NcoI	CCATGG	1 cut(s)	228
NdeII	GATC	5 cut(s)	108, 148, 276, 287, 550
NlaIII	CATG	1 cut(s)	232
NlaIV	GGNNCC	1 cut(s)	444
NmuCI	GTSAC	1 cut(s)	319
PfeI	GAWTC	1 cut(s)	293
PkrI	GCNGC	2 cut(s)	410, 517
PleI	GAGTC	4 cut(s)	57, 172, 320, 431
PpsI	GAGTC	4 cut(s)	57, 172, 320, 431
PshAI	GACNNNNGTC	1 cut(s)	48
Psp6I	CCWGG	2 cut(s)	183, 193
PspGI	CCWGG	2 cut(s)	183, 193
PspN4I	GGNNCC	1 cut(s)	444
RseI	CAYNNNNRTG	1 cut(s)	233
SaqAI	TTAA	2 cut(s)	450, 527
SatI	GCNGC	2 cut(s)	409, 516
Sau3AI	GATC	5 cut(s)	108, 148, 276, 287, 550
SchI	GAGTC	4 cut(s)	58, 173, 320, 431
ScrFI	CCNGG	2 cut(s)	185, 195
SetI	ASST	5 cut(s)	178, 199, 271, 374, 533
SfaNI	GCATC	2 cut(s)	437, 589
SmiMI	CAYNNNNRTG	1 cut(s)	233
Sse9I	AATT	6 cut(s)	417, 504, 536, 563, 593, 607
SsiI	CCGC	1 cut(s)	128
StyD4I	CCNGG	2 cut(s)	183, 193
StyI	CCWWGG	1 cut(s)	228
TaqI	TCGA	3 cut(s)	279, 549, 567
TaqII	GACCGA	1 cut(s)	338
TasI	AATT	6 cut(s)	417, 504, 536, 563, 593, 607
TfiI	GAWTC	1 cut(s)	293
Tru1I	TTAA	2 cut(s)	450, 527
Tru9I	TTAA	2 cut(s)	450, 527
TseFI	GTSAC	1 cut(s)	319
TseI	GCWGC	2 cut(s)	408, 515
Tsp45I	GTSAC	1 cut(s)	319
TspDTI	ATGAA	4 cut(s)	192, 549, 576, 597
XapI	RAATTY	4 cut(s)	536, 563, 593, 607

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.