Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr3

Orthogroup ID

OG0017790

Physical Location & Seq

Genomic Coordinates Reverse (-)

32972764 .. 32973840

Gene Structure 1077 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw3G025100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 648 bp

ATGGGAGTGGTCGCTTTGTTGTCTGGCCAACCAAAAGAAGGTGTCTTGATCGAGGCCAGATCAGAATCAAAAGGCTTCTACGAGGAAAGAGTGACCGACTCATCTGGAAGTTATCGTTTGAGAGGACTTGTTCCTGACACAACCTATGTAATCAAAGTAGTAAAAAGGGATGGTTTGGGCAGCAGTAAAATTGAGAGGGCATCACCAGACTCGGTTCCAGTTAAGACTTTCTGGTGTTTGAACAGCCAGACACATGCTATTTTAAGTTGCCATGTTGAAGGAATGAAGAATGAGGAACTCCACTCTCATCTACTGGTGGAAATCAAATCATCTAGTGACAATTCTAGGATCGAGTCCGACTTACCCAAGGGTAAGCACCTTCTGCAACTCCGGTCTAGTCTTCCATCTATCAGCCACAAATTTGAATCCGAGATTATTGAGGTCGATTTAGAGAAGAATACTCATATACATGTTGGCCCACTCAAATACGTTTATGAAGAGGCTCACCAGAAGCAGGATTTGACTCCGGCACCAGTGTTTCCTCTTATCGTAGGAGTCTCATCCATGATTGGAACACCAACACCTGGATTCACTACAACTGTAAAGAAGGAAGTGAGGAAGCCCATGTTGAGAGAAAAAACTTACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CarboxypepD_reg

Protein Analysis

215

Amino Acids

23.92

Weight (kDa)

7.81

Isoelectric Point (pI)

60.88

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
CarboxypepD_reg	PF13620	2 - 60	5.1e-07	Carboxypeptidase regulatory-like domain
DUF7152	PF23662	86 - 170	7.3e-29	Domain of unknown function (DUF7152)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017790)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0134311 RchiOBHm_Chr5g0064851 RchiOBHm_Chr7g0217491
rosa_multiflora	Rmu_sc0000368.1_g000029
rosa_roxburghii	Rroxscaffold_2G00108920 Rroxscaffold_4G00278930 Rroxscaffold_5G00368450 Rroxscaffold_6G00389850
rosa_rugosa	Rorug03G0029500
rosa_samantha	Rh3DG316600 Rh3DG316800
rosa_wichuraiana	Rw3G025100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	529
AccB7I	CCANNNNNTGG	1 cut(s)	584
AclWI	GGATC	1 cut(s)	356
AcoI	YGGCCR	1 cut(s)	25
AcsI	RAATTY	1 cut(s)	419
AfiI	CCNNNNNNNGG	3 cut(s)	38, 514, 584
AflIII	ACRYGT	1 cut(s)	469
AgsI	TTSAA	3 cut(s)	241, 278, 425
AjnI	CCWGG	1 cut(s)	583
Alw26I	GTCTC	1 cut(s)	562
AlwI	GGATC	1 cut(s)	356
AoxI	GGCC	3 cut(s)	25, 54, 475
ApeKI	GCWGC	1 cut(s)	180
ApoI	RAATTY	1 cut(s)	419
AspS9I	GGNCC	1 cut(s)	476
AsuHPI	GGTGA	2 cut(s)	195, 497
BalI	TGGCCA	1 cut(s)	27
BanI	GGYRCC	1 cut(s)	529
BbsI	GAAGAC	1 cut(s)	392
BbvI	GCAGC	1 cut(s)	192
BccI	CCATC	2 cut(s)	164, 412
BciT130I	CCWGG	1 cut(s)	585
BcoDI	GTCTC	1 cut(s)	562
BfaI	CTAG	3 cut(s)	333, 345, 396
BisI	GCNGC	1 cut(s)	181
BlsI	GCNGC	1 cut(s)	182
Bme1390I	CCNGG	1 cut(s)	585
BmgT120I	GGNCC	1 cut(s)	476
BmiI	GGNNCC	2 cut(s)	216, 531
BmrFI	CCNGG	1 cut(s)	585
BmsI	GCATC	1 cut(s)	209
BpiI	GAAGAC	1 cut(s)	392
BsaBI	GATNNNNATC	1 cut(s)	64
BsaJI	CCNNGG	1 cut(s)	366
BsaWI	WCCGGW	1 cut(s)	390
Bsc4I	CCNNNNNNNGG	3 cut(s)	38, 514, 584
Bse1I	ACTGG	3 cut(s)	218, 318, 533
Bse8I	GATNNNNATC	1 cut(s)	64
BseBI	CCWGG	1 cut(s)	585
BseDI	CCNNGG	1 cut(s)	366
BseGI	GGATG	2 cut(s)	175, 560
BseJI	GATNNNNATC	1 cut(s)	64
BseLI	CCNNNNNNNGG	3 cut(s)	38, 514, 584
BseNI	ACTGG	3 cut(s)	218, 318, 533
BseXI	GCAGC	1 cut(s)	192
BshFI	GGCC	3 cut(s)	27, 56, 477
BshNI	GGYRCC	1 cut(s)	529
BsiSI	CCGG	2 cut(s)	391, 527
BslI	CCNNNNNNNGG	3 cut(s)	38, 514, 584
BsmAI	GTCTC	1 cut(s)	562
BsnI	GGCC	3 cut(s)	27, 56, 477
Bsp143I	GATC	3 cut(s)	48, 59, 348
BspANI	GGCC	3 cut(s)	27, 56, 477
BspLI	GGNNCC	2 cut(s)	216, 531
BspPI	GGATC	1 cut(s)	356
BspT107I	GGYRCC	1 cut(s)	529
BsrI	ACTGG	3 cut(s)	218, 318, 533
BssECI	CCNNGG	1 cut(s)	366
BssMI	GATC	3 cut(s)	48, 59, 348
BssT1I	CCWWGG	1 cut(s)	366
Bst2UI	CCWGG	1 cut(s)	585
Bst4CI	ACNGT	1 cut(s)	601
Bst6I	CTCTTC	1 cut(s)	492
BstAPI	GCANNNNNTGC	1 cut(s)	382
BstF5I	GGATG	2 cut(s)	175, 560
BstKTI	GATC	3 cut(s)	51, 62, 351
BstMAI	GTCTC	1 cut(s)	562
BstMBI	GATC	3 cut(s)	48, 59, 348
BstMWI	GCNNNNNNNGC	1 cut(s)	382
BstNI	CCWGG	1 cut(s)	585
BstNSI	RCATGY	2 cut(s)	257, 473
BstSCI	CCNGG	1 cut(s)	583
BstV1I	GCAGC	1 cut(s)	192
BstV2I	GAAGAC	1 cut(s)	392
BsuRI	GGCC	3 cut(s)	27, 56, 477
BtsCI	GGATG	2 cut(s)	175, 560
BtsIMutI	CAGTG	1 cut(s)	540
Cfr13I	GGNCC	1 cut(s)	476
CviAII	CATG	5 cut(s)	254, 272, 470, 565, 625
CviJI	RGCY	8 cut(s)	27, 56, 75, 246, 414, 477, 503, 622
CviKI_1	RGCY	8 cut(s)	27, 56, 75, 246, 414, 477, 503, 622
DpnI	GATC	3 cut(s)	50, 61, 350
DpnII	GATC	3 cut(s)	48, 59, 348
EaeI	YGGCCR	1 cut(s)	25
Eam1104I	CTCTTC	1 cut(s)	492
EarI	CTCTTC	1 cut(s)	492
Eco130I	CCWWGG	1 cut(s)	366
EcoRII	CCWGG	1 cut(s)	583
EcoT14I	CCWWGG	1 cut(s)	366
ErhI	CCWWGG	1 cut(s)	366
FaeI	CATG	5 cut(s)	257, 275, 473, 568, 628
FaiI	YATR	9 cut(s)	147, 255, 273, 465, 467, 471, 495, 566, 626
FatI	CATG	5 cut(s)	253, 271, 469, 564, 624
Fnu4HI	GCNGC	1 cut(s)	181
FokI	GGATG	2 cut(s)	182, 547
Fsp4HI	GCNGC	1 cut(s)	181
FspBI	CTAG	3 cut(s)	333, 345, 396
GluI	GCNGC	1 cut(s)	181
HaeIII	GGCC	3 cut(s)	27, 56, 477
HapII	CCGG	2 cut(s)	391, 527
Hin1II	CATG	5 cut(s)	257, 275, 473, 568, 628
HinfI	GANTC	8 cut(s)	65, 98, 209, 353, 425, 523, 555, 588
HpaII	CCGG	2 cut(s)	391, 527
HphI	GGTGA	2 cut(s)	195, 497
Hpy188I	TCNGA	3 cut(s)	64, 358, 430
Hpy188III	TCNNGA	3 cut(s)	46, 105, 134
HpyAV	CCTTC	4 cut(s)	32, 272, 389, 601
HpyCH4III	ACNGT	1 cut(s)	601
HpyCH4IV	ACGT	1 cut(s)	489
HpyCH4V	TGCA	1 cut(s)	385
HpyF10VI	GCNNNNNNNGC	1 cut(s)	382
HpySE526I	ACGT	1 cut(s)	489
Hsp92II	CATG	5 cut(s)	257, 275, 473, 568, 628
Kzo9I	GATC	3 cut(s)	48, 59, 348
Lsp1109I	GCAGC	1 cut(s)	192
LweI	GCATC	1 cut(s)	209
MaeI	CTAG	3 cut(s)	333, 345, 396
MaeII	ACGT	1 cut(s)	489
MaeIII	GTNAC	2 cut(s)	91, 335
MalI	GATC	3 cut(s)	50, 61, 350
MboI	GATC	3 cut(s)	48, 59, 348
MboII	GAAGA	4 cut(s)	298, 392, 466, 509
MlsI	TGGCCA	1 cut(s)	27
MluCI	AATT	3 cut(s)	189, 340, 419
MluNI	TGGCCA	1 cut(s)	27
MlyI	GAGTC	5 cut(s)	92, 203, 362, 517, 564
MmeI	TCCRAC	1 cut(s)	381
MnlI	CCTC	9 cut(s)	46, 76, 116, 189, 286, 433, 493, 552, 609
Mox20I	TGGCCA	1 cut(s)	27
MscI	TGGCCA	1 cut(s)	27
MseI	TTAA	2 cut(s)	222, 263
MslI	CAYNNNNRTG	1 cut(s)	468
Msp20I	TGGCCA	1 cut(s)	27
MspI	CCGG	2 cut(s)	391, 527
MspR9I	CCNGG	1 cut(s)	585
MvaI	CCWGG	1 cut(s)	585
MwoI	GCNNNNNNNGC	1 cut(s)	382
NdeII	GATC	3 cut(s)	48, 59, 348
NlaIII	CATG	5 cut(s)	257, 275, 473, 568, 628
NlaIV	GGNNCC	2 cut(s)	216, 531
NmuCI	GTSAC	2 cut(s)	91, 335
NspI	RCATGY	2 cut(s)	257, 473
PciI	ACATGT	1 cut(s)	469
PfeI	GAWTC	3 cut(s)	65, 425, 588
PflMI	CCANNNNNTGG	1 cut(s)	584
PkrI	GCNGC	1 cut(s)	182
PleI	GAGTC	5 cut(s)	92, 203, 361, 517, 563
PpsI	GAGTC	5 cut(s)	92, 203, 361, 517, 563
PscI	ACATGT	1 cut(s)	469
Psp6I	CCWGG	1 cut(s)	583
PspGI	CCWGG	1 cut(s)	583
PspN4I	GGNNCC	2 cut(s)	216, 531
PspPI	GGNCC	1 cut(s)	476
RseI	CAYNNNNRTG	1 cut(s)	468
SaqAI	TTAA	2 cut(s)	222, 263
SatI	GCNGC	1 cut(s)	181
Sau3AI	GATC	3 cut(s)	48, 59, 348
Sau96I	GGNCC	1 cut(s)	476
SchI	GAGTC	5 cut(s)	92, 203, 362, 517, 564
ScrFI	CCNGG	1 cut(s)	585
SetI	ASST	6 cut(s)	43, 146, 381, 444, 492, 586
SfaNI	GCATC	1 cut(s)	209
SmiMI	CAYNNNNRTG	1 cut(s)	468
Sse9I	AATT	3 cut(s)	189, 340, 419
SspMI	CTAG	3 cut(s)	333, 345, 396
StyD4I	CCNGG	1 cut(s)	583
StyI	CCWWGG	1 cut(s)	366
TaaI	ACNGT	1 cut(s)	601
TaiI	ACGT	1 cut(s)	492
TaqI	TCGA	3 cut(s)	51, 351, 444
TaqII	GACCGA	1 cut(s)	110
TasI	AATT	3 cut(s)	189, 340, 419
TfiI	GAWTC	3 cut(s)	65, 425, 588
Tru1I	TTAA	2 cut(s)	222, 263
Tru9I	TTAA	2 cut(s)	222, 263
TscAI	CASTG	1 cut(s)	540
TseFI	GTSAC	2 cut(s)	91, 335
TseI	GCWGC	1 cut(s)	180
Tsp45I	GTSAC	2 cut(s)	91, 335
TspDTI	ATGAA	2 cut(s)	299, 510
TspRI	CASTG	1 cut(s)	540
Van91I	CCANNNNNTGG	1 cut(s)	584
XapI	RAATTY	1 cut(s)	419
XceI	RCATGY	2 cut(s)	257, 473
XspI	CTAG	3 cut(s)	333, 345, 396

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.