Rmu_sc0000368.1_g000029

Nodal modulator

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000368.1
OG0017790
Physical Location & Seq
Forward (+)
135790 .. 138685
2896 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 627 bp
atggaagggaaaaggacaagttggatgagaaggaaggaaagagacaggagtctgggtggagaggaacaaaagtattttgttggggtttttgagaagtattttgctaagatcagggagtttgccttcccgcctccagcacaggctattgatcttggctctggggagtctaaagaagctattttccaggccactccaggtttttcatcagacttctcttatatttgtgccatgggagtggtcgctttgttgtctggccaaccaaaagaaggtgtcttgatcgaggccagatcagaatcaaaaggcttctacgaggaaagagtgaccgactcatctggaagttatcgtttgagaggacttgttcctgacacaacctatgtaatcaaagtagtaaaaagggatggtttgggcagcagtaaaattgagagggcatcaccagactcggttccagttaaggaggctcttttcgcacttagagcaagagattttctcacttggagagttggaattggatttgcagcaaagtatttaaggtatgaatttgatttcctcgatcttgctaatgaattcgatgttttgaatgatgaatatcttgaatttgatgctttgaatttgatttctatggtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CarboxypepD_reg

Protein Analysis

208

Amino Acids

23.48

Weight (kDa)

5.31

Isoelectric Point (pI)

41.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CarboxypepD_reg PF13620 78 - 137 4.4e-07 Carboxypeptidase regulatory-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 128
AcoI YGGCCR 1 cut(s) 253
AcsI RAATTY 4 cut(s) 536, 563, 593, 607
AfiI CCNNNNNNNGG 1 cut(s) 266
AgsI TTSAA 3 cut(s) 577, 593, 607
AjnI CCWGG 2 cut(s) 183, 193
AluBI AGCT 1 cut(s) 176
AluI AGCT 1 cut(s) 176
Alw26I GTCTC 1 cut(s) 36
AoxI GGCC 3 cut(s) 186, 253, 282
ApeKI GCWGC 2 cut(s) 408, 515
ApoI RAATTY 4 cut(s) 536, 563, 593, 607
AsuHPI GGTGA 1 cut(s) 423
BalI TGGCCA 1 cut(s) 255
BbvI GCAGC 2 cut(s) 420, 527
BccI CCATC 1 cut(s) 392
BciT130I CCWGG 2 cut(s) 185, 195
BcoDI GTCTC 1 cut(s) 36
BisI GCNGC 2 cut(s) 409, 516
BlsI GCNGC 2 cut(s) 410, 517
Bme1390I CCNGG 2 cut(s) 185, 195
BmiI GGNNCC 1 cut(s) 444
BmrFI CCNGG 2 cut(s) 185, 195
BmsI GCATC 2 cut(s) 437, 589
BoxI GACNNNNGTC 1 cut(s) 48
BplI GAGNNNNNCTC 2 cut(s) 471, 503
BpmI CTGGAG 2 cut(s) 117, 177
BsaBI GATNNNNATC 2 cut(s) 292, 585
BsaJI CCNNGG 1 cut(s) 228
BsaXI ACNNNNNCTCC 2 cut(s) 40, 70
Bsc4I CCNNNNNNNGG 1 cut(s) 266
Bse1I ACTGG 1 cut(s) 446
Bse8I GATNNNNATC 2 cut(s) 292, 585
BseBI CCWGG 2 cut(s) 185, 195
BseDI CCNNGG 1 cut(s) 228
BseGI GGATG 2 cut(s) 30, 403
BseJI GATNNNNATC 2 cut(s) 292, 585
BseLI CCNNNNNNNGG 1 cut(s) 266
BseNI ACTGG 1 cut(s) 446
BseXI GCAGC 2 cut(s) 420, 527
BshFI GGCC 3 cut(s) 188, 255, 284
BslI CCNNNNNNNGG 1 cut(s) 266
BsmAI GTCTC 1 cut(s) 36
BsnI GGCC 3 cut(s) 188, 255, 284
Bsp143I GATC 5 cut(s) 108, 148, 276, 287, 550
Bsp19I CCATGG 1 cut(s) 228
BspACI CCGC 1 cut(s) 128
BspANI GGCC 3 cut(s) 188, 255, 284
BspLI GGNNCC 1 cut(s) 444
BsrI ACTGG 1 cut(s) 446
BssECI CCNNGG 1 cut(s) 228
BssMI GATC 5 cut(s) 108, 148, 276, 287, 550
BssT1I CCWWGG 1 cut(s) 228
Bst2UI CCWGG 2 cut(s) 185, 195
BstDEI CTNAG 2 cut(s) 105, 470
BstDSI CCRYGG 1 cut(s) 228
BstF5I GGATG 2 cut(s) 30, 403
BstKTI GATC 5 cut(s) 111, 151, 279, 290, 553
BstMAI GTCTC 1 cut(s) 36
BstMBI GATC 5 cut(s) 108, 148, 276, 287, 550
BstMWI GCNNNNNNNGC 2 cut(s) 464, 473
BstNI CCWGG 2 cut(s) 185, 195
BstPAI GACNNNNGTC 1 cut(s) 48
BstSCI CCNGG 2 cut(s) 183, 193
BstV1I GCAGC 2 cut(s) 420, 527
BstXI CCANNNNNNTGG 1 cut(s) 235
BsuRI GGCC 3 cut(s) 188, 255, 284
BtgI CCRYGG 1 cut(s) 228
BtsCI GGATG 2 cut(s) 30, 403
CviAII CATG 1 cut(s) 229
CviJI RGCY 8 cut(s) 143, 156, 176, 188, 255, 284, 303, 458
CviKI_1 RGCY 8 cut(s) 143, 156, 176, 188, 255, 284, 303, 458
DdeI CTNAG 2 cut(s) 105, 470
DpnI GATC 5 cut(s) 110, 150, 278, 289, 552
DpnII GATC 5 cut(s) 108, 148, 276, 287, 550
EaeI YGGCCR 1 cut(s) 253
Eco130I CCWWGG 1 cut(s) 228
EcoRI GAATTC 1 cut(s) 563
EcoRII CCWGG 2 cut(s) 183, 193
EcoT14I CCWWGG 1 cut(s) 228
ErhI CCWWGG 1 cut(s) 228
FaeI CATG 1 cut(s) 232
FaiI YATR 5 cut(s) 219, 230, 375, 534, 620
FatI CATG 1 cut(s) 228
FauI CCCGC 1 cut(s) 135
Fnu4HI GCNGC 2 cut(s) 409, 516
FokI GGATG 2 cut(s) 37, 410
Fsp4HI GCNGC 2 cut(s) 409, 516
GluI GCNGC 2 cut(s) 409, 516
GsuI CTGGAG 2 cut(s) 117, 177
HaeIII GGCC 3 cut(s) 188, 255, 284
Hin1II CATG 1 cut(s) 232
HinfI GANTC 5 cut(s) 49, 164, 293, 326, 437
HphI GGTGA 1 cut(s) 423
Hpy188I TCNGA 3 cut(s) 208, 292, 626
Hpy188III TCNNGA 4 cut(s) 274, 333, 362, 590
HpyAV CCTTC 4 cut(s) 24, 28, 133, 260
HpyCH4V TGCA 1 cut(s) 515
HpyF10VI GCNNNNNNNGC 2 cut(s) 464, 473
HpyF3I CTNAG 2 cut(s) 105, 470
Hsp92II CATG 1 cut(s) 232
Kzo9I GATC 5 cut(s) 108, 148, 276, 287, 550
Lsp1109I GCAGC 2 cut(s) 420, 527
LweI GCATC 2 cut(s) 437, 589
MaeIII GTNAC 1 cut(s) 319
MalI GATC 5 cut(s) 110, 150, 278, 289, 552
MboI GATC 5 cut(s) 108, 148, 276, 287, 550
MlsI TGGCCA 1 cut(s) 255
MluCI AATT 6 cut(s) 417, 504, 536, 563, 593, 607
MluNI TGGCCA 1 cut(s) 255
MlyI GAGTC 4 cut(s) 58, 173, 320, 431
MmeI TCCRAC 1 cut(s) 481
MnlI CCTC 8 cut(s) 55, 141, 274, 304, 344, 417, 448, 557
Mox20I TGGCCA 1 cut(s) 255
MscI TGGCCA 1 cut(s) 255
MseI TTAA 2 cut(s) 450, 527
MslI CAYNNNNRTG 1 cut(s) 233
Msp20I TGGCCA 1 cut(s) 255
MspR9I CCNGG 2 cut(s) 185, 195
MvaI CCWGG 2 cut(s) 185, 195
MwoI GCNNNNNNNGC 2 cut(s) 464, 473
NcoI CCATGG 1 cut(s) 228
NdeII GATC 5 cut(s) 108, 148, 276, 287, 550
NlaIII CATG 1 cut(s) 232
NlaIV GGNNCC 1 cut(s) 444
NmuCI GTSAC 1 cut(s) 319
PfeI GAWTC 1 cut(s) 293
PkrI GCNGC 2 cut(s) 410, 517
PleI GAGTC 4 cut(s) 57, 172, 320, 431
PpsI GAGTC 4 cut(s) 57, 172, 320, 431
PshAI GACNNNNGTC 1 cut(s) 48
Psp6I CCWGG 2 cut(s) 183, 193
PspGI CCWGG 2 cut(s) 183, 193
PspN4I GGNNCC 1 cut(s) 444
RseI CAYNNNNRTG 1 cut(s) 233
SaqAI TTAA 2 cut(s) 450, 527
SatI GCNGC 2 cut(s) 409, 516
Sau3AI GATC 5 cut(s) 108, 148, 276, 287, 550
SchI GAGTC 4 cut(s) 58, 173, 320, 431
ScrFI CCNGG 2 cut(s) 185, 195
SetI ASST 5 cut(s) 178, 199, 271, 374, 533
SfaNI GCATC 2 cut(s) 437, 589
SmiMI CAYNNNNRTG 1 cut(s) 233
Sse9I AATT 6 cut(s) 417, 504, 536, 563, 593, 607
SsiI CCGC 1 cut(s) 128
StyD4I CCNGG 2 cut(s) 183, 193
StyI CCWWGG 1 cut(s) 228
TaqI TCGA 3 cut(s) 279, 549, 567
TaqII GACCGA 1 cut(s) 338
TasI AATT 6 cut(s) 417, 504, 536, 563, 593, 607
TfiI GAWTC 1 cut(s) 293
Tru1I TTAA 2 cut(s) 450, 527
Tru9I TTAA 2 cut(s) 450, 527
TseFI GTSAC 1 cut(s) 319
TseI GCWGC 2 cut(s) 408, 515
Tsp45I GTSAC 1 cut(s) 319
TspDTI ATGAA 4 cut(s) 192, 549, 576, 597
XapI RAATTY 4 cut(s) 536, 563, 593, 607
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.