Rmu_sc0000449.1_g000054

acid phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000449.1
OG0006132
Physical Location & Seq
Forward (+)
240074 .. 241846
1773 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 753 bp
atgaaacgaacccaggaggtgttgttttttctgattctggctttgttctacaaggccaccggcatgaagccttgctctaagcccccgcaagtcgactgtgacggcttctgtttgagctggagactggcggtggaggccaacaatgtgcgtgggtggcgcaccgtgccaacccagtgcttgcactatctcgaaacatacatgattggaggacagtacgaccgcgacatagaattcattgttggtgaaattatgagttacgtaaacggaatcgttccctcggatgatggcatggatgcatggatcttggatgtggacgacacttgcatatccaatgtcttatactacaagggaaagagatacgggtgtgacccttacgatccatcggggttccgagcatgggctatgtctggaaagtgtccggcaattcctgctatgctgagattgtttagcaacctggtgaatatggggtttaaggttattttgcttactggaagggatgaagaaacacttggtcaagtcactatcgaaaacctgaataatcaaggatttgttgattatgaacggttgattttgaggaccgaagcttacaaagggcagggcgcggtggcgtacaagtcagcgattcggaagcaactggtggaagaaggttacaggatatgggggaatgtaggagatcaatggagtgatcttcacggagattatataggcaaccgcacgtttaagcttcctaatcccatgtactttgttccttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Acid_phosphat_B

Protein Analysis

250

Amino Acids

28.49

Weight (kDa)

5.51

Isoelectric Point (pI)

33.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Acid_phosphat_B PF03767 32 - 249 7.4e-74 HAD superfamily, subfamily IIIB (Acid phosphatase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 93
AccII CGCG 2 cut(s) 222, 602
AciI CCGC 5 cut(s) 86, 128, 220, 602, 712
AclWI GGATC 2 cut(s) 308, 371
AcsI RAATTY 1 cut(s) 230
AfaI GTAC 3 cut(s) 215, 611, 740
AfiI CCNNNNNNNGG 1 cut(s) 397
AjnI CCWGG 2 cut(s) 12, 453
AjuI GAANNNNNNNTTGG 4 cut(s) 222, 254, 492, 524
AluBI AGCT 3 cut(s) 117, 584, 724
AluI AGCT 3 cut(s) 117, 584, 724
Alw26I GTCTC 1 cut(s) 115
AlwI GGATC 2 cut(s) 308, 371
AoxI GGCC 2 cut(s) 54, 135
ApoI RAATTY 1 cut(s) 230
AspLEI GCGC 2 cut(s) 159, 602
AspS9I GGNCC 1 cut(s) 576
AsuHPI GGTGA 2 cut(s) 254, 469
AvaII GGWCC 1 cut(s) 576
BaeI ACNNNNGTAYC 2 cut(s) 349, 382
BccI CCATC 2 cut(s) 278, 388
BceAI ACGGC 1 cut(s) 118
BciT130I CCWGG 2 cut(s) 14, 455
BcoDI GTCTC 1 cut(s) 115
Bme1390I CCNGG 2 cut(s) 14, 455
Bme18I GGWCC 1 cut(s) 576
BmgT120I GGNCC 1 cut(s) 576
BmiI GGNNCC 1 cut(s) 389
BmrFI CCNGG 2 cut(s) 14, 455
BmrI ACTGGG 1 cut(s) 166
BmsI GCATC 1 cut(s) 283
BmuI ACTGGG 1 cut(s) 166
BpmI CTGGAG 1 cut(s) 139
BsaAI YACGTR 1 cut(s) 259
BsaJI CCNNGG 2 cut(s) 12, 276
BsaXI ACNNNNNCTCC 2 cut(s) 8, 38
Bsc4I CCNNNNNNNGG 1 cut(s) 397
Bse118I RCCGGY 1 cut(s) 59
Bse1I ACTGG 4 cut(s) 129, 172, 493, 639
BseBI CCWGG 2 cut(s) 14, 455
BseDI CCNNGG 2 cut(s) 12, 276
BseGI GGATG 4 cut(s) 286, 298, 313, 502
BseLI CCNNNNNNNGG 1 cut(s) 397
BseMII CTCAG 1 cut(s) 428
BseNI ACTGG 4 cut(s) 129, 172, 493, 639
Bsh1236I CGCG 2 cut(s) 222, 602
Bsh1285I CGRYCG 1 cut(s) 220
BshFI GGCC 2 cut(s) 56, 137
BsiEI CGRYCG 1 cut(s) 220
BsiSI CCGG 2 cut(s) 60, 419
BslI CCNNNNNNNGG 1 cut(s) 397
BsmAI GTCTC 1 cut(s) 115
BsnI GGCC 2 cut(s) 56, 137
Bsp143I GATC 4 cut(s) 300, 376, 673, 685
BspACI CCGC 5 cut(s) 86, 128, 220, 602, 712
BspANI GGCC 2 cut(s) 56, 137
BspCNI CTCAG 1 cut(s) 429
BspFNI CGCG 2 cut(s) 222, 602
BspLI GGNNCC 1 cut(s) 389
BspPI GGATC 2 cut(s) 308, 371
BsrFI RCCGGY 1 cut(s) 59
BsrI ACTGG 4 cut(s) 129, 172, 493, 639
BssAI RCCGGY 1 cut(s) 59
BssECI CCNNGG 2 cut(s) 12, 276
BssMI GATC 4 cut(s) 300, 376, 673, 685
Bst2UI CCWGG 2 cut(s) 14, 455
Bst4CI ACNGT 4 cut(s) 98, 163, 213, 564
BstAPI GCANNNNNTGC 1 cut(s) 428
BstBAI YACGTR 1 cut(s) 259
BstC8I GCNNGC 1 cut(s) 179
BstDEI CTNAG 2 cut(s) 78, 437
BstF5I GGATG 4 cut(s) 286, 298, 313, 502
BstFNI CGCG 2 cut(s) 222, 602
BstHHI GCGC 2 cut(s) 159, 602
BstKTI GATC 4 cut(s) 303, 379, 676, 688
BstMAI GTCTC 1 cut(s) 115
BstMBI GATC 4 cut(s) 300, 376, 673, 685
BstMCI CGRYCG 1 cut(s) 220
BstMWI GCNNNNNNNGC 4 cut(s) 134, 154, 163, 428
BstNI CCWGG 2 cut(s) 14, 455
BstSCI CCNGG 2 cut(s) 12, 453
BstSNI TACGTA 1 cut(s) 259
BstUI CGCG 2 cut(s) 222, 602
BstX2I RGATCY 1 cut(s) 300
BstYI RGATCY 1 cut(s) 300
BsuRI GGCC 2 cut(s) 56, 137
BtsCI GGATG 4 cut(s) 286, 298, 313, 502
BtsIMutI CAGTG 1 cut(s) 179
Cac8I GCNNGC 1 cut(s) 179
CfoI GCGC 2 cut(s) 159, 602
Cfr10I RCCGGY 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 576
CsiI ACCWGGT 1 cut(s) 453
Csp6I GTAC 3 cut(s) 214, 610, 739
CspCI CAANNNNNGTGG 2 cut(s) 130, 165
CviAII CATG 6 cut(s) 64, 199, 289, 297, 396, 736
CviQI GTAC 3 cut(s) 214, 610, 739
DdeI CTNAG 2 cut(s) 78, 437
DpnI GATC 4 cut(s) 302, 378, 675, 687
DpnII GATC 4 cut(s) 300, 376, 673, 685
Eco105I TACGTA 1 cut(s) 259
Eco47I GGWCC 1 cut(s) 576
EcoRI GAATTC 1 cut(s) 230
EcoRII CCWGG 2 cut(s) 12, 453
EcoT22I ATGCAT 1 cut(s) 298
FaeI CATG 6 cut(s) 67, 202, 292, 300, 399, 739
FalI AAGNNNNNCTT 2 cut(s) 492, 524
FatI CATG 6 cut(s) 63, 198, 288, 296, 395, 735
FauI CCCGC 1 cut(s) 93
FblI GTMKAC 1 cut(s) 93
FokI GGATG 4 cut(s) 293, 305, 320, 509
GlaI GCGC 2 cut(s) 158, 601
GsuI CTGGAG 1 cut(s) 139
HaeIII GGCC 2 cut(s) 56, 137
HapII CCGG 2 cut(s) 60, 419
HhaI GCGC 2 cut(s) 159, 602
Hin1II CATG 6 cut(s) 67, 202, 292, 300, 399, 739
Hin6I GCGC 2 cut(s) 157, 600
HinP1I GCGC 2 cut(s) 157, 600
HincII GTYRAC 1 cut(s) 94
HindII GTYRAC 1 cut(s) 94
HindIII AAGCTT 2 cut(s) 582, 722
HinfI GANTC 3 cut(s) 34, 267, 622
HpaII CCGG 2 cut(s) 60, 419
HphI GGTGA 2 cut(s) 254, 469
Hpy166II GTNNAC 3 cut(s) 94, 262, 313
Hpy188I TCNGA 4 cut(s) 33, 280, 392, 627
Hpy188III TCNNGA 2 cut(s) 188, 408
Hpy8I GTNNAC 3 cut(s) 94, 262, 313
HpyAV CCTTC 2 cut(s) 486, 638
HpyCH4III ACNGT 4 cut(s) 98, 163, 213, 564
HpyCH4IV ACGT 2 cut(s) 258, 716
HpyCH4V TGCA 3 cut(s) 181, 296, 324
HpyF10VI GCNNNNNNNGC 4 cut(s) 134, 154, 163, 428
HpyF3I CTNAG 2 cut(s) 78, 437
HpySE526I ACGT 2 cut(s) 258, 716
Hsp92II CATG 6 cut(s) 67, 202, 292, 300, 399, 739
HspAI GCGC 2 cut(s) 157, 600
Kzo9I GATC 4 cut(s) 300, 376, 673, 685
LweI GCATC 1 cut(s) 283
MabI ACCWGGT 1 cut(s) 453
MaeII ACGT 2 cut(s) 258, 716
MaeIII GTNAC 5 cut(s) 98, 254, 365, 517, 647
MalI GATC 4 cut(s) 302, 378, 675, 687
MboI GATC 4 cut(s) 300, 376, 673, 685
MboII GAAGA 3 cut(s) 512, 653, 680
MflI RGATCY 1 cut(s) 300
MluCI AATT 3 cut(s) 230, 246, 423
MnlI CCTC 5 cut(s) 10, 127, 200, 286, 567
Mph1103I ATGCAT 1 cut(s) 298
MseI TTAA 3 cut(s) 471, 720, 751
MslI CAYNNNNRTG 1 cut(s) 62
MspI CCGG 2 cut(s) 60, 419
MspR9I CCNGG 2 cut(s) 14, 455
MvaI CCWGG 2 cut(s) 14, 455
MvnI CGCG 2 cut(s) 222, 602
MwoI GCNNNNNNNGC 4 cut(s) 134, 154, 163, 428
NdeII GATC 4 cut(s) 300, 376, 673, 685
NlaIII CATG 6 cut(s) 67, 202, 292, 300, 399, 739
NlaIV GGNNCC 1 cut(s) 389
NmuCI GTSAC 3 cut(s) 98, 365, 517
NsiI ATGCAT 1 cut(s) 298
PfeI GAWTC 3 cut(s) 34, 267, 622
Ppu21I YACGTR 1 cut(s) 259
Psp6I CCWGG 2 cut(s) 12, 453
PspGI CCWGG 2 cut(s) 12, 453
PspN4I GGNNCC 1 cut(s) 389
PspPI GGNCC 1 cut(s) 576
PsuI RGATCY 1 cut(s) 300
RsaI GTAC 3 cut(s) 215, 611, 740
RsaNI GTAC 3 cut(s) 214, 610, 739
RseI CAYNNNNRTG 1 cut(s) 62
SalI GTCGAC 1 cut(s) 92
SaqAI TTAA 3 cut(s) 471, 720, 751
Sau3AI GATC 4 cut(s) 300, 376, 673, 685
Sau96I GGNCC 1 cut(s) 576
ScrFI CCNGG 2 cut(s) 14, 455
SexAI ACCWGGT 1 cut(s) 453
SfaNI GCATC 1 cut(s) 283
SinI GGWCC 1 cut(s) 576
SmiMI CAYNNNNRTG 1 cut(s) 62
SnaBI TACGTA 1 cut(s) 259
Sse9I AATT 3 cut(s) 230, 246, 423
SsiI CCGC 5 cut(s) 86, 128, 220, 602, 712
StyD4I CCNGG 2 cut(s) 12, 453
TaaI ACNGT 4 cut(s) 98, 163, 213, 564
TaiI ACGT 2 cut(s) 261, 719
TaqI TCGA 3 cut(s) 93, 189, 525
TaqII GACCGA 1 cut(s) 593
TasI AATT 3 cut(s) 230, 246, 423
TatI WGTACW 1 cut(s) 738
TfiI GAWTC 3 cut(s) 34, 267, 622
Tru1I TTAA 3 cut(s) 471, 720, 751
Tru9I TTAA 3 cut(s) 471, 720, 751
TscAI CASTG 1 cut(s) 179
TseFI GTSAC 3 cut(s) 98, 365, 517
Tsp45I GTSAC 3 cut(s) 98, 365, 517
TspDTI ATGAA 5 cut(s) 17, 80, 223, 513, 573
TspGWI ACGGA 2 cut(s) 279, 708
TspRI CASTG 1 cut(s) 179
VpaK11BI GGWCC 1 cut(s) 576
XapI RAATTY 1 cut(s) 230
XmiI GTMKAC 1 cut(s) 93
Zsp2I ATGCAT 1 cut(s) 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.