Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014731.1

Orthogroup ID

OG0006132

Physical Location & Seq

Genomic Coordinates Reverse (-)

1866 .. 3908

Gene Structure 2043 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014731.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 753 bp

atgaaacgaacccaggaggtgttgttttttctgattctggctttgttctacaaggccaccggcatgaagccttgctctaagcccccgcaagtcgactgtgacggcttctgtttgagctggagactggcggtggaggccaacaatgtgcgtgggtggcgcaccgtgccaacccagtgcttgcactatctcgaaacatatatgattggaggacagtacgaccgcgacatagaattcattgttggtgaaattatgagttacgtaaacggaatcgttccctcggatgatggcatggatgcatggatcttggatgtggacgacacttgcatatccaatgtcttatactacaagggaaagagatacgggtgtgacccttacgatccatcggggttccgagcatgggctatgtctggaaagtgtccggcaattcctgccatgctgagattgtttagcaacctggtgaatatggggtttaaggttattttgcttactggaagggatgaagaaacacttggtcaagtcactatcgaaaacctgaataatcaaggatttgttgattatgaacggttgattttgaggaccgaagcttacaaagggcagggcgcggtggcgtacaagtcagcgattcggaagcaactggtggaagaaggttacaggatatgggggaatgtaggagatcaatggagtgatcttcacggagattatataggcaaccgcacgtttaagcttcctaatcccatgtactttgttccttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Acid_phosphat_B

Protein Analysis

250

Amino Acids

28.49

Weight (kDa)

5.51

Isoelectric Point (pI)

33.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006132)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G38600 AT2G38600
fragaria_vesca	FvH4_6g09510 FvH4_6g09510 FvH4_6g09510 FvH4_6g09510 FvH4_6g09510
malus_domestica	MD04G1176900.v1.1 MD12G1192100.v1.1
prunus_persica	Prupe.6G296600_v2.0.a1 Prupe.6G296600_v2.0.a1
pyrus_communis	pycom04g15620 pycom12g17910
rosa_chinensis	RchiOBHm_Chr3g0460091 RchiOBHm_Chr3g0460101
rosa_laevigata	RLG00000025044
rosa_multiflora	Rmu_sc0000449.1_g000054 Rmu_sc0014731.1_g000001
rosa_roxburghii	Rroxscaffold_6G00419850
rosa_rugosa	Rorug03G0039300 Rorug03G0039400 Rorug03G0039500
rosa_samantha	Rh3AG097900 Rh3BG101000 Rh3CG103100 Rh3DG102300
rosa_wichuraiana	Rw3G008260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	93
AccII	CGCG	2 cut(s)	222, 602
AciI	CCGC	5 cut(s)	86, 128, 220, 602, 712
AclWI	GGATC	2 cut(s)	308, 371
AcsI	RAATTY	1 cut(s)	230
AfaI	GTAC	3 cut(s)	215, 611, 740
AfiI	CCNNNNNNNGG	1 cut(s)	397
AjnI	CCWGG	2 cut(s)	12, 453
AjuI	GAANNNNNNNTTGG	4 cut(s)	222, 254, 492, 524
AluBI	AGCT	3 cut(s)	117, 584, 724
AluI	AGCT	3 cut(s)	117, 584, 724
Alw26I	GTCTC	1 cut(s)	115
AlwI	GGATC	2 cut(s)	308, 371
AoxI	GGCC	2 cut(s)	54, 135
ApoI	RAATTY	1 cut(s)	230
AspLEI	GCGC	2 cut(s)	159, 602
AspS9I	GGNCC	1 cut(s)	576
AsuHPI	GGTGA	2 cut(s)	254, 469
AvaII	GGWCC	1 cut(s)	576
BaeI	ACNNNNGTAYC	2 cut(s)	349, 382
BccI	CCATC	2 cut(s)	278, 388
BceAI	ACGGC	1 cut(s)	118
BciT130I	CCWGG	2 cut(s)	14, 455
BcoDI	GTCTC	1 cut(s)	115
Bme1390I	CCNGG	2 cut(s)	14, 455
Bme18I	GGWCC	1 cut(s)	576
BmgT120I	GGNCC	1 cut(s)	576
BmiI	GGNNCC	1 cut(s)	389
BmrFI	CCNGG	2 cut(s)	14, 455
BmrI	ACTGGG	1 cut(s)	166
BmsI	GCATC	1 cut(s)	283
BmuI	ACTGGG	1 cut(s)	166
BpmI	CTGGAG	1 cut(s)	139
BsaAI	YACGTR	1 cut(s)	259
BsaJI	CCNNGG	2 cut(s)	12, 276
BsaXI	ACNNNNNCTCC	2 cut(s)	8, 38
Bsc4I	CCNNNNNNNGG	1 cut(s)	397
Bse118I	RCCGGY	1 cut(s)	59
Bse1I	ACTGG	4 cut(s)	129, 172, 493, 639
BseBI	CCWGG	2 cut(s)	14, 455
BseDI	CCNNGG	2 cut(s)	12, 276
BseGI	GGATG	4 cut(s)	286, 298, 313, 502
BseLI	CCNNNNNNNGG	1 cut(s)	397
BseMII	CTCAG	1 cut(s)	428
BseNI	ACTGG	4 cut(s)	129, 172, 493, 639
Bsh1236I	CGCG	2 cut(s)	222, 602
Bsh1285I	CGRYCG	1 cut(s)	220
BshFI	GGCC	2 cut(s)	56, 137
BsiEI	CGRYCG	1 cut(s)	220
BsiSI	CCGG	2 cut(s)	60, 419
BslI	CCNNNNNNNGG	1 cut(s)	397
BsmAI	GTCTC	1 cut(s)	115
BsnI	GGCC	2 cut(s)	56, 137
Bsp143I	GATC	4 cut(s)	300, 376, 673, 685
BspACI	CCGC	5 cut(s)	86, 128, 220, 602, 712
BspANI	GGCC	2 cut(s)	56, 137
BspCNI	CTCAG	1 cut(s)	429
BspFNI	CGCG	2 cut(s)	222, 602
BspLI	GGNNCC	1 cut(s)	389
BspPI	GGATC	2 cut(s)	308, 371
BsrFI	RCCGGY	1 cut(s)	59
BsrI	ACTGG	4 cut(s)	129, 172, 493, 639
BssAI	RCCGGY	1 cut(s)	59
BssECI	CCNNGG	2 cut(s)	12, 276
BssMI	GATC	4 cut(s)	300, 376, 673, 685
Bst2UI	CCWGG	2 cut(s)	14, 455
Bst4CI	ACNGT	4 cut(s)	98, 163, 213, 564
BstAPI	GCANNNNNTGC	1 cut(s)	428
BstBAI	YACGTR	1 cut(s)	259
BstC8I	GCNNGC	1 cut(s)	179
BstDEI	CTNAG	2 cut(s)	78, 437
BstF5I	GGATG	4 cut(s)	286, 298, 313, 502
BstFNI	CGCG	2 cut(s)	222, 602
BstHHI	GCGC	2 cut(s)	159, 602
BstKTI	GATC	4 cut(s)	303, 379, 676, 688
BstMAI	GTCTC	1 cut(s)	115
BstMBI	GATC	4 cut(s)	300, 376, 673, 685
BstMCI	CGRYCG	1 cut(s)	220
BstMWI	GCNNNNNNNGC	4 cut(s)	134, 154, 163, 428
BstNI	CCWGG	2 cut(s)	14, 455
BstSCI	CCNGG	2 cut(s)	12, 453
BstSNI	TACGTA	1 cut(s)	259
BstUI	CGCG	2 cut(s)	222, 602
BstX2I	RGATCY	1 cut(s)	300
BstYI	RGATCY	1 cut(s)	300
BsuRI	GGCC	2 cut(s)	56, 137
BtsCI	GGATG	4 cut(s)	286, 298, 313, 502
BtsIMutI	CAGTG	1 cut(s)	179
Cac8I	GCNNGC	1 cut(s)	179
CfoI	GCGC	2 cut(s)	159, 602
Cfr10I	RCCGGY	1 cut(s)	59
Cfr13I	GGNCC	1 cut(s)	576
CsiI	ACCWGGT	1 cut(s)	453
Csp6I	GTAC	3 cut(s)	214, 610, 739
CspCI	CAANNNNNGTGG	2 cut(s)	130, 165
CviAII	CATG	6 cut(s)	64, 289, 297, 396, 433, 736
CviQI	GTAC	3 cut(s)	214, 610, 739
DdeI	CTNAG	2 cut(s)	78, 437
DpnI	GATC	4 cut(s)	302, 378, 675, 687
DpnII	GATC	4 cut(s)	300, 376, 673, 685
Eco105I	TACGTA	1 cut(s)	259
Eco47I	GGWCC	1 cut(s)	576
EcoRI	GAATTC	1 cut(s)	230
EcoRII	CCWGG	2 cut(s)	12, 453
EcoT22I	ATGCAT	1 cut(s)	298
FaeI	CATG	6 cut(s)	67, 292, 300, 399, 436, 739
FalI	AAGNNNNNCTT	2 cut(s)	492, 524
FatI	CATG	6 cut(s)	63, 288, 296, 395, 432, 735
FauI	CCCGC	1 cut(s)	93
FblI	GTMKAC	1 cut(s)	93
FokI	GGATG	4 cut(s)	293, 305, 320, 509
GlaI	GCGC	2 cut(s)	158, 601
GsuI	CTGGAG	1 cut(s)	139
HaeIII	GGCC	2 cut(s)	56, 137
HapII	CCGG	2 cut(s)	60, 419
HhaI	GCGC	2 cut(s)	159, 602
Hin1II	CATG	6 cut(s)	67, 292, 300, 399, 436, 739
Hin6I	GCGC	2 cut(s)	157, 600
HinP1I	GCGC	2 cut(s)	157, 600
HincII	GTYRAC	1 cut(s)	94
HindII	GTYRAC	1 cut(s)	94
HindIII	AAGCTT	2 cut(s)	582, 722
HinfI	GANTC	3 cut(s)	34, 267, 622
HpaII	CCGG	2 cut(s)	60, 419
HphI	GGTGA	2 cut(s)	254, 469
Hpy166II	GTNNAC	3 cut(s)	94, 262, 313
Hpy188I	TCNGA	4 cut(s)	33, 280, 392, 627
Hpy188III	TCNNGA	2 cut(s)	188, 408
Hpy8I	GTNNAC	3 cut(s)	94, 262, 313
HpyAV	CCTTC	2 cut(s)	486, 638
HpyCH4III	ACNGT	4 cut(s)	98, 163, 213, 564
HpyCH4IV	ACGT	2 cut(s)	258, 716
HpyCH4V	TGCA	3 cut(s)	181, 296, 324
HpyF10VI	GCNNNNNNNGC	4 cut(s)	134, 154, 163, 428
HpyF3I	CTNAG	2 cut(s)	78, 437
HpySE526I	ACGT	2 cut(s)	258, 716
Hsp92II	CATG	6 cut(s)	67, 292, 300, 399, 436, 739
HspAI	GCGC	2 cut(s)	157, 600
Kzo9I	GATC	4 cut(s)	300, 376, 673, 685
LweI	GCATC	1 cut(s)	283
MabI	ACCWGGT	1 cut(s)	453
MaeII	ACGT	2 cut(s)	258, 716
MaeIII	GTNAC	5 cut(s)	98, 254, 365, 517, 647
MalI	GATC	4 cut(s)	302, 378, 675, 687
MboI	GATC	4 cut(s)	300, 376, 673, 685
MboII	GAAGA	3 cut(s)	512, 653, 680
MflI	RGATCY	1 cut(s)	300
MluCI	AATT	3 cut(s)	230, 246, 423
MnlI	CCTC	5 cut(s)	10, 127, 200, 286, 567
Mph1103I	ATGCAT	1 cut(s)	298
MseI	TTAA	3 cut(s)	471, 720, 751
MslI	CAYNNNNRTG	1 cut(s)	62
MspI	CCGG	2 cut(s)	60, 419
MspR9I	CCNGG	2 cut(s)	14, 455
MvaI	CCWGG	2 cut(s)	14, 455
MvnI	CGCG	2 cut(s)	222, 602
MwoI	GCNNNNNNNGC	4 cut(s)	134, 154, 163, 428
NdeII	GATC	4 cut(s)	300, 376, 673, 685
NlaIII	CATG	6 cut(s)	67, 292, 300, 399, 436, 739
NlaIV	GGNNCC	1 cut(s)	389
NmuCI	GTSAC	3 cut(s)	98, 365, 517
NsiI	ATGCAT	1 cut(s)	298
PfeI	GAWTC	3 cut(s)	34, 267, 622
Ppu21I	YACGTR	1 cut(s)	259
Psp6I	CCWGG	2 cut(s)	12, 453
PspGI	CCWGG	2 cut(s)	12, 453
PspN4I	GGNNCC	1 cut(s)	389
PspPI	GGNCC	1 cut(s)	576
PsuI	RGATCY	1 cut(s)	300
RsaI	GTAC	3 cut(s)	215, 611, 740
RsaNI	GTAC	3 cut(s)	214, 610, 739
RseI	CAYNNNNRTG	1 cut(s)	62
SalI	GTCGAC	1 cut(s)	92
SaqAI	TTAA	3 cut(s)	471, 720, 751
Sau3AI	GATC	4 cut(s)	300, 376, 673, 685
Sau96I	GGNCC	1 cut(s)	576
ScrFI	CCNGG	2 cut(s)	14, 455
SexAI	ACCWGGT	1 cut(s)	453
SfaNI	GCATC	1 cut(s)	283
SinI	GGWCC	1 cut(s)	576
SmiMI	CAYNNNNRTG	1 cut(s)	62
SnaBI	TACGTA	1 cut(s)	259
Sse9I	AATT	3 cut(s)	230, 246, 423
SsiI	CCGC	5 cut(s)	86, 128, 220, 602, 712
StyD4I	CCNGG	2 cut(s)	12, 453
TaaI	ACNGT	4 cut(s)	98, 163, 213, 564
TaiI	ACGT	2 cut(s)	261, 719
TaqI	TCGA	3 cut(s)	93, 189, 525
TaqII	GACCGA	1 cut(s)	593
TasI	AATT	3 cut(s)	230, 246, 423
TatI	WGTACW	1 cut(s)	738
TfiI	GAWTC	3 cut(s)	34, 267, 622
Tru1I	TTAA	3 cut(s)	471, 720, 751
Tru9I	TTAA	3 cut(s)	471, 720, 751
TscAI	CASTG	1 cut(s)	179
TseFI	GTSAC	3 cut(s)	98, 365, 517
Tsp45I	GTSAC	3 cut(s)	98, 365, 517
TspDTI	ATGAA	5 cut(s)	17, 80, 223, 513, 573
TspGWI	ACGGA	2 cut(s)	279, 708
TspRI	CASTG	1 cut(s)	179
VpaK11BI	GGWCC	1 cut(s)	576
XapI	RAATTY	1 cut(s)	230
XmiI	GTMKAC	1 cut(s)	93
Zsp2I	ATGCAT	1 cut(s)	298

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.