Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000539.1

Orthogroup ID

OG0005380

Physical Location & Seq

Genomic Coordinates Reverse (-)

57805 .. 58125

Gene Structure 321 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000539.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 321 bp

atgtccctttcaccccatgaaggagaagatcaagagtctgaatatacaatgacagaaacagaagaggactctttctcaaaagacaatgaagttgacaacgaagaaattgcagagaccctagatgatgattacaaagggaagcctagaaagtctgggatggtttgttctgaagatgtggatagccatcctttaaagtttaggaggggaaaggttgttgacatgcaatttcagaacaatagacaaggaggctcaaatttaggcaaggaaaagtgttgggagagaatgaaaatgccaaggctgatgctaaaggcgcagatataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CaM_binding

Protein Analysis

106

Amino Acids

12.28

Weight (kDa)

4.78

Isoelectric Point (pI)

47.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005380)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G39380 AT5G39380 AT5G39380 AT5G39380 AT5G39380
fragaria_vesca	FvH4_6g47500 FvH4_6g47500 FvH4_6g47500 FvH4_6g47500
malus_domestica	MD09G1061400.v1.1
prunus_persica	Prupe.3G258800_v2.0.a1 Prupe.3G258800_v2.0.a1 Prupe.3G258800_v2.0.a1
pyrus_communis	pycom17g05570
rosa_chinensis	RchiOBHm_Chr2g0166531
rosa_laevigata	RLG00000021627 RLG00000023838
rosa_multiflora	Rmu_sc0000539.1_g000013 Rmu_sc0010842.1_g000006
rosa_roxburghii	Rroxscaffold_2G00084780 Rroxscaffold_6G00406250
rosa_rugosa	Rorug02G0523900 Rorug02G0524000
rosa_samantha	Rh2AG589900 Rh2BG602000 Rh2CG572700 Rh2DG612600 Rh3BG229600
rosa_wichuraiana	Rw2G049170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	253
AcuI	CTGAAG	1 cut(s)	189
AfiI	CCNNNNNNNGG	1 cut(s)	20
AloI	GAACNNNNNNTCC	2 cut(s)	148, 180
Alw26I	GTCTC	1 cut(s)	107
ApoI	RAATTY	1 cut(s)	253
AspLEI	GCGC	1 cut(s)	313
AsuHPI	GGTGA	1 cut(s)	3
BccI	CCATC	2 cut(s)	151, 192
BcgI	CGANNNNNNTGC	2 cut(s)	89, 123
BcoDI	GTCTC	1 cut(s)	107
BfaI	CTAG	2 cut(s)	119, 144
BmsI	GCATC	1 cut(s)	291
BsaBI	GATNNNNATC	1 cut(s)	183
BsaI	GGTCTC	1 cut(s)	107
BsaJI	CCNNGG	1 cut(s)	293
Bsc4I	CCNNNNNNNGG	1 cut(s)	20
Bse8I	GATNNNNATC	1 cut(s)	183
BseDI	CCNNGG	1 cut(s)	293
BseGI	GGATG	2 cut(s)	162, 184
BseJI	GATNNNNATC	1 cut(s)	183
BseLI	CCNNNNNNNGG	1 cut(s)	20
BslI	CCNNNNNNNGG	1 cut(s)	20
BsmAI	GTCTC	1 cut(s)	107
Bso31I	GGTCTC	1 cut(s)	107
Bsp143I	GATC	1 cut(s)	28
BspTNI	GGTCTC	1 cut(s)	107
BssECI	CCNNGG	1 cut(s)	293
BssMI	GATC	1 cut(s)	28
BssT1I	CCWWGG	1 cut(s)	293
Bst6I	CTCTTC	1 cut(s)	57
BstF5I	GGATG	2 cut(s)	162, 184
BstHHI	GCGC	1 cut(s)	313
BstKTI	GATC	1 cut(s)	31
BstMAI	GTCTC	1 cut(s)	107
BstMBI	GATC	1 cut(s)	28
BstMWI	GCNNNNNNNGC	1 cut(s)	310
BstNSI	RCATGY	1 cut(s)	223
BtsCI	GGATG	2 cut(s)	162, 184
CfoI	GCGC	1 cut(s)	313
CviAII	CATG	2 cut(s)	17, 220
CviJI	RGCY	4 cut(s)	142, 183, 249, 298
CviKI_1	RGCY	4 cut(s)	142, 183, 249, 298
DpnI	GATC	1 cut(s)	30
DpnII	GATC	1 cut(s)	28
DraI	TTTAAA	1 cut(s)	192
Eam1104I	CTCTTC	1 cut(s)	57
EarI	CTCTTC	1 cut(s)	57
Eco130I	CCWWGG	1 cut(s)	293
Eco31I	GGTCTC	1 cut(s)	107
Eco57I	CTGAAG	1 cut(s)	189
EcoT14I	CCWWGG	1 cut(s)	293
ErhI	CCWWGG	1 cut(s)	293
FaeI	CATG	2 cut(s)	20, 223
FaiI	YATR	4 cut(s)	18, 45, 221, 319
FatI	CATG	2 cut(s)	16, 219
FokI	GGATG	2 cut(s)	169, 171
FspBI	CTAG	2 cut(s)	119, 144
GlaI	GCGC	1 cut(s)	312
HhaI	GCGC	1 cut(s)	313
Hin1II	CATG	2 cut(s)	20, 223
Hin6I	GCGC	1 cut(s)	311
HinP1I	GCGC	1 cut(s)	311
HincII	GTYRAC	2 cut(s)	94, 217
HindII	GTYRAC	2 cut(s)	94, 217
HinfI	GANTC	2 cut(s)	35, 68
HphI	GGTGA	1 cut(s)	3
Hpy166II	GTNNAC	2 cut(s)	94, 217
Hpy188I	TCNGA	3 cut(s)	40, 169, 231
Hpy188III	TCNNGA	1 cut(s)	32
Hpy8I	GTNNAC	2 cut(s)	94, 217
HpyAV	CCTTC	1 cut(s)	14
HpyCH4V	TGCA	2 cut(s)	110, 223
HpyF10VI	GCNNNNNNNGC	1 cut(s)	310
Hsp92II	CATG	2 cut(s)	20, 223
HspAI	GCGC	1 cut(s)	311
Kzo9I	GATC	1 cut(s)	28
LpnPI	CCDG	1 cut(s)	138
LweI	GCATC	1 cut(s)	291
MaeI	CTAG	2 cut(s)	119, 144
MalI	GATC	1 cut(s)	30
MboI	GATC	1 cut(s)	28
MboII	GAAGA	4 cut(s)	38, 74, 113, 182
MluCI	AATT	3 cut(s)	105, 224, 253
MlyI	GAGTC	2 cut(s)	44, 62
MnlI	CCTC	3 cut(s)	58, 195, 239
MseI	TTAA	1 cut(s)	191
MwoI	GCNNNNNNNGC	1 cut(s)	310
NdeII	GATC	1 cut(s)	28
NlaIII	CATG	2 cut(s)	20, 223
NspI	RCATGY	1 cut(s)	223
PleI	GAGTC	2 cut(s)	43, 62
PpsI	GAGTC	2 cut(s)	43, 62
SaqAI	TTAA	1 cut(s)	191
Sau3AI	GATC	1 cut(s)	28
SchI	GAGTC	2 cut(s)	44, 62
SetI	ASST	1 cut(s)	213
SfaNI	GCATC	1 cut(s)	291
SgeI	CNNG	9 cut(s)	29, 44, 131, 156, 165, 232, 254, 274, 306
Sse9I	AATT	3 cut(s)	105, 224, 253
SspMI	CTAG	2 cut(s)	119, 144
StyI	CCWWGG	1 cut(s)	293
TasI	AATT	3 cut(s)	105, 224, 253
Tru1I	TTAA	1 cut(s)	191
Tru9I	TTAA	1 cut(s)	191
TspDTI	ATGAA	3 cut(s)	33, 102, 299
XapI	RAATTY	1 cut(s)	253
XceI	RCATGY	1 cut(s)	223
XspI	CTAG	2 cut(s)	119, 144

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.