Rmu_sc0000575.1_g000018

Translation initiation factor eIF3 subunit 135

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000575.1
OG0011973
Physical Location & Seq
Reverse (-)
100026 .. 116364
16339 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 5673 bp
atggctcccaaaacagggaaagccaagccacacaaatccaagggagacaagaagaagaaagaagagaaagttttacctaccgtaatcgagattaccattgaaacgccagatgactcgcaagtgaccctaaagggtatctctacggacaggatcttagatgtgagaaagctgttgggggtccacgtagatacatgtcacttcaccaatttctccctatcacacgaggtgcgaggacccagactgaaagatactgtggacatcctctctctcaaaccctgccacctcaccatcgtcgaagaggactacacggaagagcaagccgtggctcacattcgaagactggttgacatcgtcgcctgcacgacgtcgtttggctcgtcgtctacttcacccagaacccccggttctgcttcggttccggctccggttcggtcgagttctaaagagtccggtttagacgagggcgacgagcacaatgcggttccgaagaccaaagtttcgagtccgattccgatcgccggcgagaaaggcggcgagtcggcaatgtatcctccgccgaggctcggccagttttacgacttcttctccttgtctcaccttactcctccactccactacgttagaagatctagccgtccgttccttgaggacaaggcagaggaggacctgtttcaaattgatgttcgggtttgtagtgggaagccgacgactatagtagcatccagaaaagggttctaccctgctggaaaacgtcctcttattactcactctctggttgctttgcttcaacagattagccggccgttcgatgctgcatacaatgctgtcatgaaggctttcaccgagcacaataaatttgggaaccttccttatggttttcgggcaaacacatgggttgtccctccggttgttgctgagaacccgtctgttttcccgccacttcctctagaagatgaaaattggggaggaaatgggggtgggcagggaagagacggtaaacacgataacaggccatgggcgaaagagtttgccattcttgcagcaatgccttgtgcaacagcagaggagaggcaagttcgagatcgaaaggcctttctgcttcacagtttatttgtcgacgtctcagttcttaaagctgttgcagctattaagagcctaattgacactcatcaatcttccctaaatgattccactctttcacttcatcatgaggaaaaaattggagatttaatcattaagatcgttagagatgcacctgatgcaagtgtaaaggtggattgcaagaatgatggtagtcgagttctaggaatgccacaagaagaagttactcagagaaacctactcaaaggcataacagctgatgagagtgcaactgttcatgatacttccacactaggtgttgtggttgttaggcattgtggatttactgctgttgtgaaagttttagctgaggtgaattgggtggggaaacctgttcctcaggacattgaaattgaggaccagcctgaaggaggtgcaaatgccttgaatgttaacagcctgagaatgctattgcaacagtcatccctccttcagtcatcaactacggttcaacgaagccagagcacagatcttgaaaatttacgttctgctaggtccttagtaaggaaagtactcgaagaaagtttattaaggttgcagggtgggccatctaatcacaccaagtcgatcagatgggagctaggagcatgttgggtgcaacatttgcaaaatcaggcttcagcgaaaaatgagccgaagaaaaatgaagaagctaagatagaaccggctgttaagggcctcggaaagcaaggtggactgctaaaggaaataaagaagaaaatggatatcaggagcagtaaaactgaacagggcaaggaagttcttgggggtaacaaccttgatcttaataagaattcagtcaccgccagtcaggaggagttagaaaagcgagatgccgaaaaggaaataaattggagaaggctacttcctgatgcatcctattcgcggctcaaagaatcagatactggtctccaccttaagtcacctgatgagttgattgaaatggcacacaagtattacgctgatactgcacttccaaaactggtggcagattttggctcccttgaactttcaccagttgatggaaggacattgacagattttatgcatacaaggggtttgaaaatgtgttccctgggacgcgtggttgaacttgcagataagctccctcatgtacaatcactctgtatccatgagatggttgtgcgagcatacaaacacatactgcaagctgttgtagcagcagttgataatgtcgcagacttggctgcatccatagcagcatgtctaaatattctgctaggaaccccatcacctgaaaatgtggatggagacattacttgtgaggatacgttaaaatggaagtgggtggaaacattccttttgaagaggtttggatggcaatggaaacatgaaagcgttgaggactttagaaagtttgccattcttcgtggattgtgccataaggttggccttgagcttgtgccaagggattatgatatggacacttcgtctccttttaggaaatcagatatagtaagcatggtccctgtgtacaagcatgttgcatgttcatctgctgatggacgtacacttttggaatcttccaagacttccttggataaaggtaaactggaggatgctgttaattatggcactaaggcgttgtcaaaacttgtatcagtatgtgggccttatcatcgaatgactgctggagcatatagtcttctcgctgtagtactgtatcacactggggattttaatcaggcaaccatctatcagcaaaaagcattggatattaatgagagagagcttggacttgatcatcctgatacaatgaaaagttacggggatttagctgtgttctactaccgacttcaacatacagagttggccttgaagtacgtcaatcgtgcgctgtatcttttgcacctaacatgtgggccgtctcatccaaacacggctgccacctatatcaatgtagcaatgatggaagaaggtttggggaacgtccatgttgctcttaggtacgtcaatcgtgcgctgtatcttttgcacctaacttgtgggccgtctcatccaaacacggctgccacctatatcaatgttgcaatgatggaagaaggtttggggaacgtccatgttgctcttaggtacctccatgaagctctcaagtgcaatcaaaggctacttggagctgatcatatacagactgctgctagctatcatgccatagctatcgcactttctttgatggaggcatactcattaagtgttcagcacgaacaaactaccttgcaaattctgcaggcgaaactcgggtcagaggatctacgcacacaggatgcggctgcatggcttgagtattttgagtccaaagctttggagcagcaagaagctgcacggaatggtactccaaagccagatgcttcaatctccagcaaaggtcatttaagtgtatcagatcttttggattatataacaccagatgctgatatgaaagctagagaggcccaaaggaaagctcgtttgaaggttaaaggcaaaccaggtcagaacggggaggcagtctctgatgagtaccagaaggatgaaaatttgttaccaagtcatcctgttgcagagaatttaagtgataaagagaacaagtctgaagcacaattaggagaacctaggaatgagaaatatgattcccgtctacttgagcaatcaataatatttgctacacatgatgatctggcacaagatgacaactcagatgaaggctggcaagaggctgttcctaaaggccggtcacttataggtcgcaaatctactgggtcaaggaggccaagccttgaaaaactgaatactaactttatcaatacatcccagtcatcaagatatcgaggcaaggccaataatttcacatcccccaaaacaagcccaaatgagcctgcttcttcaactggacctgctcctccagtgtcaaagaagtttgtcaagagtgcaagcttcagccctaagcaaaacaactctagcacatcagctaccggagctgcagagagattgccaaacccaaagtcagcaccatctaccccagcttctgttgatcaagtcatcaagtctgtaagtccgatcagtgttcagtcaactggaaaactcttttcctacaaagaagttgcagtggctccacctgggacaattgtgaaggcagtggcggagcagttaccaaagccgattgtacaaatttctcaggtgggccaggagacacctacaacagaggtcactgttggtgaagtgacggcaattaaagatgtgaaggataaaaaaaataagaaatcgacaggagagaaacaggttatggtttctgagaaaagcccttctgtagtacgatcagcaaaactgaaggattctgtggcaaaggagtccttggaagttgtgaagcatgctagtgttggagtacaagttgaagctgaatctgaagctgtggaattagaaaacactgcttttgaaggtgcagaagttgaaaatgtaaaagttcctgttcctagcgttgagatttctgatgcttcccaaagtccaaataccacagctgctgaatgtggaccatcagaccccctagggccagacagttgccccaggacttcctctgattcagaacctccatctgctttaactgagcctagaaccaacaatccttctaatacaggggagggaaagtcacgtgatttacccaatggcgacatagttaaaccagtgccaactggtggggaaaaggtagatgaacaagaaactggaaaggagacgagcaaaaaactttctgcagccgcacctccttttaatccatcccccattccagtttttggctcaattccggttccagttccaggtctcaaagatcatggagggattttgcccccacctgtaaatattcctccgatgcttgcagttaatcctgtccgtagatcaccccatcagtcagcgacagcaagagttccttatggtccacgactttctggtggctataacagatctggaagtcgggtttcacgtaataaacatagctttcacaatggtgagcacaccggggatggtcctcccagaataatgaacccacatgcagctgagtttgtacctggccaaccttgggttcaaaatggctatccactgtctcccaatggtttcttgtcttccccaaatggttatccagtgtccccaaatggatatccggtatcaccgaatggtactccggtgaatcaaaacgggtctccgacatctccagtcagttcagatgagtcatcaccaattgtgactgctgatattggtgttggagcaaatactgaaggtgcagggaaggagactaatgataagttatcagtacaagttgaatgtgacaagcaaccaattgaaggagagctgcaggaagaacagtctttagataatgtaaacgttcctcctgaaactgaagaaaagcctattgataccgatacagttcctggtgatactattgtggaaaaggagactagcaatctagtagttgaggaaaaaccaagcaaatgttggggagattatagcgataatgaagctgaggtcattgaggttagtagttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0001101 GO:0008150 GO:0009719 GO:0009725 GO:0009737 GO:0010033 GO:0033993 GO:0042221 GO:0050896 GO:0097305 GO:1901700
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CLU CLU_N TPR_12 eIF3_p135

Protein Analysis

1890

Amino Acids

205.61

Weight (kDa)

6.09

Isoelectric Point (pI)

47.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CLU_N PF15044 48 - 118 3.2e-09 Mitochondrial function, CLU-N-term
eIF3_p135 PF12807 717 - 860 7.5e-23 Translation initiation factor eIF3 subunit 135
TPR_12 PF13424 901 - 962 2.2e-06 Tetratricopeptide repeat
TPR_NPHP3 PF24885 902 - 1000 2.7e-07 Nephrocystin-3 TPR domain
TPR_12 PF13424 930 - 1000 1.7e-12 Tetratricopeptide repeat
TPR_10 PF13374 930 - 971 2.2e-09 Tetratricopeptide repeat
TPR_12 PF13424 972 - 1042 2.5e-09 Tetratricopeptide repeat
TPR_NPHP3 PF24885 1013 - 1131 3.8e-06 Nephrocystin-3 TPR domain
TPR_12 PF13424 1014 - 1080 2.2e-08 Tetratricopeptide repeat
TPR_12 PF13424 1056 - 1130 2e-10 Tetratricopeptide repeat
TPR_10 PF13374 1056 - 1096 4.3e-07 Tetratricopeptide repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011973)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G28080
fragaria_vesca FvH4_3g24640 FvH4_3g24640 FvH4_3g24640
malus_domestica MD16G1258600.v1.1
prunus_persica Prupe.1G101800_v2.0.a1
pyrus_communis pycom16g22600
rosa_chinensis RchiOBHm_Chr4g0405441
rosa_laevigata RLG00000008842
rosa_multiflora Rmu_co8255623.1_g000001 Rmu_sc0000575.1_g000017 Rmu_sc0000575.1_g000018
rosa_roxburghii Rroxscaffold_5G00349900
rosa_rugosa Rorug04G0060200
rosa_samantha Rh4AG131900 Rh4BG126800 Rh4CG139300 Rh4DG125900
rosa_wichuraiana Rw4G010680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 2 cut(s) 368, 1122
Acc36I ACCTGC 1 cut(s) 4042
Acc65I GGTACC 1 cut(s) 3234
AccB1I GGYRCC 1 cut(s) 3234
AccB7I CCANNNNNTGG 4 cut(s) 2162, 2278, 4829, 4925
AccI GTMKAC 3 cut(s) 383, 1116, 3778
AccII CGCG 2 cut(s) 2026, 2223
AciI CCGC 9 cut(s) 479, 531, 554, 935, 1944, 2026, 3428, 4280, 4890
AclI AACGTT 1 cut(s) 5511
AclWI GGATC 2 cut(s) 158, 3417
AcoI YGGCCR 3 cut(s) 565, 800, 5200
AcsI RAATTY 7 cut(s) 854, 1618, 1933, 3381, 3676, 3706, 4308
AcuI CTGAAG 9 cut(s) 1527, 1556, 1743, 3753, 4060, 4487, 4563, 5424, 5547
AcvI CACGTG 1 cut(s) 4787
AcyI GRCGYC 2 cut(s) 365, 1119
AdeI CACNNNGTG 2 cut(s) 226, 1397
AflII CTTAAG 1 cut(s) 2057
AflIII ACRYGT 3 cut(s) 191, 2221, 3017
AhdI GACNNNNNGTC 1 cut(s) 2590
AjnI CCWGG 8 cut(s) 2214, 3628, 4255, 4323, 4700, 4948, 5197, 5557
AjuI GAANNNNNNNTTGG 2 cut(s) 5196, 5228
AleI CACNNNNGTG 1 cut(s) 5136
AloI GAACNNNNNNTCC 2 cut(s) 4741, 4773
Alw21I GWGCWC 4 cut(s) 474, 849, 1607, 5145
AlwI GGATC 2 cut(s) 158, 3417
AlwNI CAGNNNCTG 6 cut(s) 2045, 3572, 3653, 4166, 4658, 5558
Ama87I CYCGRG 1 cut(s) 3398
ApoI RAATTY 7 cut(s) 854, 1618, 1933, 3381, 3676, 3706, 4308
ArsI GACNNNNNNTTYG 6 cut(s) 481, 513, 3386, 3418, 4127, 4159
AseI ATTAAT 1 cut(s) 2880
Asp700I GAANNNNTTC 1 cut(s) 836
Asp718I GGTACC 1 cut(s) 3234
AspA2I CCTAGG 2 cut(s) 3752, 4681
AspLEI GCGC 2 cut(s) 2998, 3124
AsuC2I CCSGG 2 cut(s) 402, 5149
AsuII TTCGAA 1 cut(s) 334
AsuNHI GCTAGC 1 cut(s) 3299
AvaI CYCGRG 1 cut(s) 3398
AvrII CCTAGG 2 cut(s) 3752, 4681
AxyI CCTNAGG 1 cut(s) 1479
BaeI ACNNNNGTAYC 4 cut(s) 5298, 5331, 5556, 5589
BalI TGGCCA 1 cut(s) 5202
BanI GGYRCC 1 cut(s) 3234
BauI CACGAG 1 cut(s) 221
BbrPI CACGTG 1 cut(s) 4787
BbsI GAAGAC 4 cut(s) 343, 494, 2798, 5244
Bbv12I GWGCWC 4 cut(s) 474, 849, 1607, 5145
BbvCI CCTCAGC 2 cut(s) 1449, 5649
BceAI ACGGC 8 cut(s) 305, 618, 787, 3010, 3057, 3136, 3183, 4380
BcgI CGANNNNNNTGC 4 cut(s) 458, 492, 2004, 2038
BciT130I CCWGG 8 cut(s) 2216, 3630, 4257, 4325, 4702, 4950, 5199, 5559
BciVI GTATCC 3 cut(s) 558, 2279, 2422
BclI TGATCA 3 cut(s) 2902, 3280, 4171
BcnI CCSGG 2 cut(s) 402, 5149
BfmI CTRYAG 7 cut(s) 711, 2814, 3386, 4119, 4446, 4884, 5480
BfrI CTTAAG 1 cut(s) 2057
BfuAI ACCTGC 1 cut(s) 4042
BfuI GTATCC 3 cut(s) 558, 2279, 2422
BglII AGATCT 4 cut(s) 626, 1609, 3544, 5093
BlnI CCTAGG 2 cut(s) 3752, 4681
BmcAI AGTACT 2 cut(s) 1653, 2820
BmeRI GACNNNNNGTC 1 cut(s) 2590
BmeT110I CYCGRG 1 cut(s) 3398
BmrI ACTGGG 3 cut(s) 2841, 3906, 3946
BmtI GCTAGC 1 cut(s) 3303
BmuI ACTGGG 3 cut(s) 2841, 3906, 3946
BpiI GAAGAC 4 cut(s) 343, 494, 2798, 5244
BplI GAGNNNNNCTC 4 cut(s) 3329, 3361, 3635, 3667
BpmI CTGGAG 5 cut(s) 2735, 2814, 3502, 4026, 5325
Bpu10I CCTNAGC 3 cut(s) 1449, 4083, 5649
Bpu14I TTCGAA 1 cut(s) 334
BpuEI CTTGAG 5 cut(s) 665, 2576, 3236, 3461, 3803
BpuMI CCSGG 2 cut(s) 402, 5149
BsaAI YACGTR 3 cut(s) 184, 4787, 5114
BsaBI GATNNNNATC 2 cut(s) 512, 2841
BsaHI GRCGYC 2 cut(s) 365, 1119
BsaI GGTCTC 3 cut(s) 2054, 4958, 5334
BsaWI WCCGGW 7 cut(s) 424, 449, 904, 4112, 4936, 5290, 5311
Bse118I RCCGGY 4 cut(s) 518, 798, 1804, 3870
Bse21I CCTNAGG 1 cut(s) 1479
Bse3DI GCAATG 5 cut(s) 549, 1050, 2489, 3072, 3198
Bse8I GATNNNNATC 2 cut(s) 512, 2841
BseBI CCWGG 8 cut(s) 2216, 3630, 4257, 4325, 4702, 4950, 5199, 5559
BseJI GATNNNNATC 2 cut(s) 512, 2841
BseMI GCAATG 5 cut(s) 549, 1050, 2489, 3072, 3198
BseRI GAGGAG 5 cut(s) 594, 674, 1079, 1970, 4029
BseX3I CGGCCG 1 cut(s) 800
BseYI CCCAGC 1 cut(s) 4159
BsgI GTGCAG 5 cut(s) 343, 2094, 3465, 4599, 5430
Bsh1236I CGCG 2 cut(s) 2026, 2223
Bsh1285I CGRYCG 3 cut(s) 434, 516, 803
BshNI GGYRCC 1 cut(s) 3234
BsiEI CGRYCG 3 cut(s) 434, 516, 803
BsiHKAI GWGCWC 4 cut(s) 474, 849, 1607, 5145
BsiHKCI CYCGRG 1 cut(s) 3398
BslFI GGGAC 5 cut(s) 884, 2232, 2612, 4273, 5260
BsmBI CGTCTC 6 cut(s) 984, 1126, 2598, 3033, 3159, 4859
BsmFI GGGAC 5 cut(s) 884, 2232, 2612, 4273, 5260
BsmI GAATGC 2 cut(s) 1314, 1551
Bso31I GGTCTC 3 cut(s) 2054, 4958, 5334
BsoBI CYCGRG 1 cut(s) 3398
Bsp119I TTCGAA 1 cut(s) 334
Bsp1286I GDGCHC 4 cut(s) 474, 849, 1607, 5145
Bsp1407I TGTACA 3 cut(s) 2254, 2634, 4303
Bsp19I CCATGG 1 cut(s) 1013
BspACI CCGC 9 cut(s) 479, 531, 554, 935, 1944, 2026, 3428, 4280, 4890
BspFNI CGCG 2 cut(s) 2026, 2223
BspHI TCATGA 3 cut(s) 828, 1207, 1378
BspMAI CTGCAG 4 cut(s) 3390, 4123, 4888, 5484
BspMI ACCTGC 1 cut(s) 4042
BspOI GCTAGC 1 cut(s) 3303
BspPI GGATC 2 cut(s) 158, 3417
BspQI GCTCTTC 1 cut(s) 306
BspT104I TTCGAA 1 cut(s) 334
BspT107I GGYRCC 1 cut(s) 3234
BspTI CTTAAG 1 cut(s) 2057
BspTNI GGTCTC 3 cut(s) 2054, 4958, 5334
BsrDI GCAATG 5 cut(s) 549, 1050, 2489, 3072, 3198
BsrFI RCCGGY 4 cut(s) 518, 798, 1804, 3870
BsrGI TGTACA 3 cut(s) 2254, 2634, 4303
BssAI RCCGGY 4 cut(s) 518, 798, 1804, 3870
BssNI GRCGYC 2 cut(s) 365, 1119
BssSI CACGAG 1 cut(s) 221
BssT1I CCWWGG 8 cut(s) 39, 1013, 2567, 2697, 3752, 4491, 4681, 5207
Bst2BI CACGAG 1 cut(s) 221
Bst2UI CCWGG 8 cut(s) 2216, 3630, 4257, 4325, 4702, 4950, 5199, 5559
Bst6I CTCTTC 5 cut(s) 57, 291, 306, 982, 2462
BstACI GRCGYC 2 cut(s) 365, 1119
BstAFI CTTAAG 1 cut(s) 2057
BstAPI GCANNNNNTGC 4 cut(s) 821, 1259, 1744, 3385
BstAUI TGTACA 3 cut(s) 2254, 2634, 4303
BstBAI YACGTR 3 cut(s) 184, 4787, 5114
BstBI TTCGAA 1 cut(s) 334
BstDSI CCRYGG 2 cut(s) 321, 1013
BstENI CCTNNNNNAGG 2 cut(s) 1509, 1642
BstFNI CGCG 2 cut(s) 2026, 2223
BstHHI GCGC 2 cut(s) 2998, 3124
BstMCI CGRYCG 3 cut(s) 434, 516, 803
BstNI CCWGG 8 cut(s) 2216, 3630, 4257, 4325, 4702, 4950, 5199, 5559
BstNSI RCATGY 8 cut(s) 195, 1731, 2367, 2645, 2652, 3021, 4511, 5183
BstSFI CTRYAG 7 cut(s) 711, 2814, 3386, 4119, 4446, 4884, 5480
BstUI CGCG 2 cut(s) 2026, 2223
BstV2I GAAGAC 4 cut(s) 343, 494, 2798, 5244
BstX2I RGATCY 6 cut(s) 150, 626, 1609, 3409, 3544, 5093
BstXI CCANNNNNNTGG 2 cut(s) 2549, 3463
BstYI RGATCY 6 cut(s) 150, 626, 1609, 3409, 3544, 5093
BstZI CGGCCG 1 cut(s) 800
Bsu36I CCTNAGG 1 cut(s) 1479
BsuI GTATCC 3 cut(s) 558, 2279, 2422
BtgI CCRYGG 2 cut(s) 321, 1013
BtsI GCAGTG 3 cut(s) 4251, 4281, 4563
BveI ACCTGC 1 cut(s) 4042
CaiI CAGNNNCTG 6 cut(s) 2045, 3572, 3653, 4166, 4658, 5558
CciI TCATGA 3 cut(s) 828, 1207, 1378
CfoI GCGC 2 cut(s) 2998, 3124
Cfr10I RCCGGY 4 cut(s) 518, 798, 1804, 3870
CseI GACGC 1 cut(s) 2229
CsiI ACCWGGT 1 cut(s) 3628
CspCI CAANNNNNGTGG 2 cut(s) 2106, 2141
DraIII CACNNNGTG 2 cut(s) 226, 1397
DriI GACNNNNNGTC 1 cut(s) 2590
EaeI YGGCCR 3 cut(s) 565, 800, 5200
EagI CGGCCG 1 cut(s) 800
Eam1104I CTCTTC 5 cut(s) 57, 291, 306, 982, 2462
Eam1105I GACNNNNNGTC 1 cut(s) 2590
EarI CTCTTC 5 cut(s) 57, 291, 306, 982, 2462
EciI GGCGGA 2 cut(s) 543, 4295
EclXI CGGCCG 1 cut(s) 800
Eco130I CCWWGG 8 cut(s) 39, 1013, 2567, 2697, 3752, 4491, 4681, 5207
Eco147I AGGCCT 1 cut(s) 1091
Eco31I GGTCTC 3 cut(s) 2054, 4958, 5334
Eco32I GATATC 3 cut(s) 1867, 3965, 5288
Eco52I CGGCCG 1 cut(s) 800
Eco57I CTGAAG 9 cut(s) 1527, 1556, 1743, 3753, 4060, 4487, 4563, 5424, 5547
Eco72I CACGTG 1 cut(s) 4787
Eco81I CCTNAGG 1 cut(s) 1479
Eco88I CYCGRG 1 cut(s) 3398
EcoNI CCTNNNNNAGG 2 cut(s) 1509, 1642
EcoO109I RGGNCCY 4 cut(s) 233, 664, 1635, 1816
EcoRI GAATTC 1 cut(s) 1933
EcoRII CCWGG 8 cut(s) 2214, 3628, 4255, 4323, 4700, 4948, 5197, 5557
EcoRV GATATC 3 cut(s) 1867, 3965, 5288
EcoT14I CCWWGG 8 cut(s) 39, 1013, 2567, 2697, 3752, 4491, 4681, 5207
EcoT22I ATGCAT 2 cut(s) 2017, 2190
ErhI CCWWGG 8 cut(s) 39, 1013, 2567, 2697, 3752, 4491, 4681, 5207
Esp3I CGTCTC 6 cut(s) 984, 1126, 2598, 3033, 3159, 4859
FalI AAGNNNNNCTT 6 cut(s) 2681, 2713, 4475, 4507, 5044, 5076
FaqI GGGAC 5 cut(s) 884, 2232, 2612, 4273, 5260
FauI CCCGC 1 cut(s) 942
FbaI TGATCA 3 cut(s) 2902, 3280, 4171
FblI GTMKAC 3 cut(s) 383, 1116, 3778
GlaI GCGC 2 cut(s) 2997, 3123
GsaI CCCAGC 1 cut(s) 4163
GsuI CTGGAG 5 cut(s) 2735, 2814, 3502, 4026, 5325
HgaI GACGC 1 cut(s) 2229
HhaI GCGC 2 cut(s) 2998, 3124
Hin1I GRCGYC 2 cut(s) 365, 1119
Hin6I GCGC 2 cut(s) 2996, 3122
HinP1I GCGC 2 cut(s) 2996, 3122
HincII GTYRAC 4 cut(s) 346, 1117, 1534, 4212
HindII GTYRAC 4 cut(s) 346, 1117, 1534, 4212
HindIII AAGCTT 2 cut(s) 3459, 4072
HpaI GTTAAC 1 cut(s) 1534
Hpy99I CGWCG 8 cut(s) 296, 356, 367, 370, 382, 470, 709, 1121
Hsp92I GRCGYC 2 cut(s) 365, 1119
HspAI GCGC 2 cut(s) 2996, 3122
KpnI GGTACC 1 cut(s) 3238
KroI GCCGGC 2 cut(s) 518, 798
KroNI GCCGGC 2 cut(s) 520, 800
Ksp22I TGATCA 3 cut(s) 2902, 3280, 4171
KspAI GTTAAC 1 cut(s) 1534
LguI GCTCTTC 1 cut(s) 306
MabI ACCWGGT 1 cut(s) 3628
MfeI CAATTG 3 cut(s) 4263, 5367, 5466
MflI RGATCY 6 cut(s) 150, 626, 1609, 3409, 3544, 5093
MhlI GDGCHC 4 cut(s) 474, 849, 1607, 5145
MlsI TGGCCA 1 cut(s) 5202
MluI ACGCGT 1 cut(s) 2221
MluNI TGGCCA 1 cut(s) 5202
MlyI GAGTC 7 cut(s) 107, 455, 511, 545, 3461, 4496, 5366
MmeI TCCRAC 3 cut(s) 4498, 5357, 5371
Mox20I TGGCCA 1 cut(s) 5202
Mph1103I ATGCAT 2 cut(s) 2017, 2190
MreI CGCCGGCG 1 cut(s) 518
MroNI GCCGGC 2 cut(s) 518, 798
MroXI GAANNNNTTC 1 cut(s) 836
MscI TGGCCA 1 cut(s) 5202
MslI CAYNNNNRTG 3 cut(s) 3534, 4512, 5136
Msp20I TGGCCA 1 cut(s) 5202
MspA1I CMGCKG 3 cut(s) 1358, 4655, 5186
MspCI CTTAAG 1 cut(s) 2057
MunI CAATTG 3 cut(s) 4263, 5367, 5466
Mva1269I GAATGC 2 cut(s) 1314, 1551
MvaI CCWGG 8 cut(s) 2216, 3630, 4257, 4325, 4702, 4950, 5199, 5559
MvnI CGCG 2 cut(s) 2026, 2223
NaeI GCCGGC 2 cut(s) 520, 800
NciI CCSGG 2 cut(s) 402, 5149
NcoI CCATGG 1 cut(s) 1013
NgoMIV GCCGGC 2 cut(s) 518, 798
NheI GCTAGC 1 cut(s) 3299
NmeAIII GCCGAG 2 cut(s) 543, 582
NsiI ATGCAT 2 cut(s) 2017, 2190
NspI RCATGY 8 cut(s) 195, 1731, 2367, 2645, 2652, 3021, 4511, 5183
NspV TTCGAA 1 cut(s) 334
OliI CACNNNNGTG 1 cut(s) 5136
PaeI GCATGC 1 cut(s) 4511
PagI TCATGA 3 cut(s) 828, 1207, 1378
PasI CCCWGGG 1 cut(s) 2215
PceI AGGCCT 1 cut(s) 1091
PciI ACATGT 2 cut(s) 191, 3017
PciSI GCTCTTC 1 cut(s) 306
PcsI WCGNNNNNNNCGW 4 cut(s) 374, 465, 999, 5110
PctI GAATGC 2 cut(s) 1314, 1551
PdiI GCCGGC 2 cut(s) 520, 800
PdmI GAANNNNTTC 1 cut(s) 836
PfeI GAWTC 9 cut(s) 508, 1187, 2036, 2681, 3770, 4472, 4538, 4715, 5317
PflFI GACNNNGTC 1 cut(s) 350
PflMI CCANNNNNTGG 4 cut(s) 2162, 2278, 4829, 4925
Ple19I CGATCG 1 cut(s) 516
PleI GAGTC 7 cut(s) 107, 454, 510, 544, 3460, 4495, 5365
PmaCI CACGTG 1 cut(s) 4787
PmlI CACGTG 1 cut(s) 4787
PpsI GAGTC 7 cut(s) 107, 454, 510, 544, 3460, 4495, 5365
Ppu21I YACGTR 3 cut(s) 184, 4787, 5114
PpuMI RGGWCCY 3 cut(s) 233, 664, 1635
PscI ACATGT 2 cut(s) 191, 3017
PshBI ATTAAT 1 cut(s) 2880
Psp1406I AACGTT 1 cut(s) 5511
Psp5II RGGWCCY 3 cut(s) 233, 664, 1635
Psp6I CCWGG 8 cut(s) 2214, 3628, 4255, 4323, 4700, 4948, 5197, 5557
PspCI CACGTG 1 cut(s) 4787
PspFI CCCAGC 1 cut(s) 4159
PspGI CCWGG 8 cut(s) 2214, 3628, 4255, 4323, 4700, 4948, 5197, 5557
PspPPI RGGWCCY 3 cut(s) 233, 664, 1635
PstI CTGCAG 4 cut(s) 3390, 4123, 4888, 5484
PstNI CAGNNNCTG 6 cut(s) 2045, 3572, 3653, 4166, 4658, 5558
PsuI RGATCY 6 cut(s) 150, 626, 1609, 3409, 3544, 5093
PsyI GACNNNGTC 1 cut(s) 350
PvuI CGATCG 1 cut(s) 516
PvuII CAGCTG 3 cut(s) 1358, 4655, 5186
RseI CAYNNNNRTG 3 cut(s) 3534, 4512, 5136
SalI GTCGAC 1 cut(s) 1115
SapI GCTCTTC 1 cut(s) 306
ScaI AGTACT 2 cut(s) 1653, 2820
SchI GAGTC 7 cut(s) 107, 455, 511, 545, 3461, 4496, 5366
SduI GDGCHC 4 cut(s) 474, 849, 1607, 5145
SexAI ACCWGGT 1 cut(s) 3628
SfcI CTRYAG 7 cut(s) 711, 2814, 3386, 4119, 4446, 4884, 5480
SfuI TTCGAA 1 cut(s) 334
SgrAI CRCCGGYG 1 cut(s) 518
SmiMI CAYNNNNRTG 3 cut(s) 3534, 4512, 5136
SmlI CTYRAG 6 cut(s) 644, 2057, 2555, 3251, 3440, 3782
SmoI CTYRAG 6 cut(s) 644, 2057, 2555, 3251, 3440, 3782
SphI GCATGC 1 cut(s) 4511
SseBI AGGCCT 1 cut(s) 1091
SsiI CCGC 9 cut(s) 479, 531, 554, 935, 1944, 2026, 3428, 4280, 4890
SspI AATATT 3 cut(s) 2374, 3798, 4993
StuI AGGCCT 1 cut(s) 1091
StyI CCWWGG 8 cut(s) 39, 1013, 2567, 2697, 3752, 4491, 4681, 5207
TaqII GACCGA 1 cut(s) 420
TatI WGTACW 7 cut(s) 1651, 2254, 2634, 2818, 4303, 4522, 5440
TauI GCSGC 4 cut(s) 534, 2029, 3431, 4892
TfiI GAWTC 9 cut(s) 508, 1187, 2036, 2681, 3770, 4472, 4538, 4715, 5317
TspGWI ACGGA 5 cut(s) 158, 323, 627, 3499, 5012
Tth111I GACNNNGTC 1 cut(s) 350
Van91I CCANNNNNTGG 4 cut(s) 2162, 2278, 4829, 4925
Vha464I CTTAAG 1 cut(s) 2057
VspI ATTAAT 1 cut(s) 2880
XagI CCTNNNNNAGG 2 cut(s) 1509, 1642
XapI RAATTY 7 cut(s) 854, 1618, 1933, 3381, 3676, 3706, 4308
XbaI TCTAGA 1 cut(s) 946
XceI RCATGY 8 cut(s) 195, 1731, 2367, 2645, 2652, 3021, 4511, 5183
XcmI CCANNNNNNNNNTGG 2 cut(s) 2695, 5619
XmaJI CCTAGG 2 cut(s) 3752, 4681
XmiI GTMKAC 3 cut(s) 383, 1116, 3778
XmnI GAANNNNTTC 1 cut(s) 836
ZraI GACGTC 2 cut(s) 366, 1120
ZrmI AGTACT 2 cut(s) 1653, 2820
Zsp2I ATGCAT 2 cut(s) 2017, 2190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.