Rmu_sc0000806.1_g000028

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000806.1
OG0015776
Physical Location & Seq
Reverse (-)
101840 .. 102226
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000806.1_g000028.1.cds

Sequence Viewer

Length: 387 bp
atgaacgaagaagaccctagaaggctgtgggtctcactcgaagaaagatttggcaacatccatgactccctgcttcctgaactagaagtgagatggcatagcctccgcttacatgatttcaagtcagttattgactataactcggaagcacttcgcattaaatccttaatggaattctgtagaaaagatatcacagatgcaatgttgattaagaggactctctctaccttccccgtctctgcattgatggttactaagaactatcaaatcgatgttactgcaggacggatcacaaggtttcatgagctcattggagctatgaatgttgctgaaaagcatgacaacatccttgtgaagaactataatttgatacccatgagaacataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

128

Amino Acids

15.07

Weight (kDa)

6.97

Isoelectric Point (pI)

45.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 106
AclWI GGATC 1 cut(s) 296
AcsI RAATTY 1 cut(s) 173
AgsI TTSAA 1 cut(s) 121
AjuI GAANNNNNNNTTGG 2 cut(s) 33, 65
AluBI AGCT 2 cut(s) 307, 317
AluI AGCT 2 cut(s) 307, 317
Alw21I GWGCWC 1 cut(s) 309
Alw26I GTCTC 2 cut(s) 37, 241
AlwI GGATC 1 cut(s) 296
ApoI RAATTY 1 cut(s) 173
Asp700I GAANNNNTTC 1 cut(s) 150
BanII GRGCYC 1 cut(s) 309
BbsI GAAGAC 1 cut(s) 18
Bbv12I GWGCWC 1 cut(s) 309
BccI CCATC 2 cut(s) 87, 241
BcgI CGANNNNNNTGC 2 cut(s) 260, 294
BcoDI GTCTC 2 cut(s) 37, 241
BfaI CTAG 2 cut(s) 18, 83
BfmI CTRYAG 2 cut(s) 178, 279
BmsI GCATC 1 cut(s) 187
BpiI GAAGAC 1 cut(s) 18
Bsa29I ATCGAT 1 cut(s) 270
BsaI GGTCTC 1 cut(s) 37
Bse3DI GCAATG 1 cut(s) 207
BseCI ATCGAT 1 cut(s) 270
BseGI GGATG 2 cut(s) 57, 345
BseMI GCAATG 1 cut(s) 207
BshVI ATCGAT 1 cut(s) 270
BsiHKAI GWGCWC 1 cut(s) 309
BsmAI GTCTC 2 cut(s) 37, 241
BsmBI CGTCTC 1 cut(s) 241
Bso31I GGTCTC 1 cut(s) 37
Bsp1286I GDGCHC 1 cut(s) 309
Bsp143I GATC 1 cut(s) 288
BspACI CCGC 1 cut(s) 106
BspDI ATCGAT 1 cut(s) 270
BspHI TCATGA 1 cut(s) 301
BspMAI CTGCAG 1 cut(s) 283
BspPI GGATC 1 cut(s) 296
BspTNI GGTCTC 1 cut(s) 37
BsrDI GCAATG 1 cut(s) 207
BssMI GATC 1 cut(s) 288
BstDEI CTNAG 1 cut(s) 255
BstF5I GGATG 2 cut(s) 57, 345
BstKTI GATC 1 cut(s) 291
BstMAI GTCTC 2 cut(s) 37, 241
BstMBI GATC 1 cut(s) 288
BstSFI CTRYAG 2 cut(s) 178, 279
BstV2I GAAGAC 1 cut(s) 18
Bsu15I ATCGAT 1 cut(s) 270
BsuTUI ATCGAT 1 cut(s) 270
BtsCI GGATG 2 cut(s) 57, 345
CciI TCATGA 1 cut(s) 301
ClaI ATCGAT 1 cut(s) 270
CviAII CATG 5 cut(s) 62, 113, 302, 338, 376
CviJI RGCY 4 cut(s) 25, 102, 307, 317
CviKI_1 RGCY 4 cut(s) 25, 102, 307, 317
DdeI CTNAG 1 cut(s) 255
DpnI GATC 1 cut(s) 290
DpnII GATC 1 cut(s) 288
Ecl136II GAGCTC 1 cut(s) 307
Eco24I GRGCYC 1 cut(s) 309
Eco31I GGTCTC 1 cut(s) 37
Eco32I GATATC 1 cut(s) 190
Eco53kI GAGCTC 1 cut(s) 307
EcoICRI GAGCTC 1 cut(s) 307
EcoRI GAATTC 1 cut(s) 173
EcoRV GATATC 1 cut(s) 190
EcoT38I GRGCYC 1 cut(s) 309
Esp3I CGTCTC 1 cut(s) 241
FaeI CATG 5 cut(s) 65, 116, 305, 341, 379
FatI CATG 5 cut(s) 61, 112, 301, 337, 375
FokI GGATG 2 cut(s) 44, 332
FriOI GRGCYC 1 cut(s) 309
FspBI CTAG 2 cut(s) 18, 83
Hin1II CATG 5 cut(s) 65, 116, 305, 341, 379
HinfI GANTC 2 cut(s) 65, 217
Hpy188I TCNGA 1 cut(s) 145
Hpy188III TCNNGA 2 cut(s) 77, 302
HpyAV CCTTC 2 cut(s) 15, 238
HpyCH4V TGCA 3 cut(s) 200, 242, 281
HpyF3I CTNAG 1 cut(s) 255
Hsp92II CATG 5 cut(s) 65, 116, 305, 341, 379
Kzo9I GATC 1 cut(s) 288
LmnI GCTCC 1 cut(s) 314
LpnPI CCDG 3 cut(s) 83, 90, 267
LweI GCATC 1 cut(s) 187
MaeI CTAG 2 cut(s) 18, 83
MaeIII GTNAC 2 cut(s) 250, 274
MalI GATC 1 cut(s) 290
MboI GATC 1 cut(s) 288
MboII GAAGA 4 cut(s) 20, 23, 53, 367
MhlI GDGCHC 1 cut(s) 309
MluCI AATT 2 cut(s) 173, 364
MlyI GAGTC 2 cut(s) 59, 211
MnlI CCTC 2 cut(s) 113, 207
MroXI GAANNNNTTC 1 cut(s) 150
MseI TTAA 3 cut(s) 159, 167, 210
MslI CAYNNNNRTG 1 cut(s) 350
NdeII GATC 1 cut(s) 288
NlaIII CATG 5 cut(s) 65, 116, 305, 341, 379
PagI TCATGA 1 cut(s) 301
PdmI GAANNNNTTC 1 cut(s) 150
PleI GAGTC 2 cut(s) 59, 211
PpsI GAGTC 2 cut(s) 59, 211
Psp124BI GAGCTC 1 cut(s) 309
PstI CTGCAG 1 cut(s) 283
RseI CAYNNNNRTG 1 cut(s) 350
SacI GAGCTC 1 cut(s) 309
SaqAI TTAA 3 cut(s) 159, 167, 210
Sau3AI GATC 1 cut(s) 288
SchI GAGTC 2 cut(s) 59, 211
SduI GDGCHC 1 cut(s) 309
SetI ASST 4 cut(s) 230, 299, 309, 319
SfaNI GCATC 1 cut(s) 187
SfcI CTRYAG 2 cut(s) 178, 279
SmiMI CAYNNNNRTG 1 cut(s) 350
Sse9I AATT 2 cut(s) 173, 364
SsiI CCGC 1 cut(s) 106
SspMI CTAG 2 cut(s) 18, 83
SstI GAGCTC 1 cut(s) 309
TaqI TCGA 2 cut(s) 39, 270
TasI AATT 2 cut(s) 173, 364
Tru1I TTAA 3 cut(s) 159, 167, 210
Tru9I TTAA 3 cut(s) 159, 167, 210
TspDTI ATGAA 3 cut(s) 17, 290, 335
TspGWI ACGGA 1 cut(s) 301
XapI RAATTY 1 cut(s) 173
XmnI GAANNNNTTC 1 cut(s) 150
XspI CTAG 2 cut(s) 18, 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.