Rmu_ssc0000434.1_g000034

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000434.1
OG0015776
Physical Location & Seq
Forward (+)
150482 .. 150877
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000434.1_g000034.1.cds

Sequence Viewer

Length: 396 bp
atgactcgtcatatggatgattcgctccagtacgagtgtatgaatgaagaagaccctagaaggctgtgggtctcactcgatgaaagatttggcaacgtccgtgactccctgcttcctgacctagaagtgagatggcatagtctccgcttctgtgatttcaagtcagttcttgactacaactcggaaacacttcgcattaaattcttcatggaattctgtggtaaagagatcatagatgggatgttgattgagaagactctctctacattccccgtctctgcattgatggttgataagaactgtcgaatcgatgttattataggatggatcacaaggtttcatgagctcattggagctatgaatgtcgctgaaaagcatgacaacatccttgtgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

131

Amino Acids

15.5

Weight (kDa)

5.04

Isoelectric Point (pI)

51.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 145
AclWI GGATC 1 cut(s) 335
AcsI RAATTY 2 cut(s) 200, 212
AfaI GTAC 1 cut(s) 32
AgsI TTSAA 1 cut(s) 160
AluBI AGCT 2 cut(s) 346, 356
AluI AGCT 2 cut(s) 346, 356
Alw21I GWGCWC 1 cut(s) 348
Alw26I GTCTC 3 cut(s) 76, 146, 280
AlwI GGATC 1 cut(s) 335
ApoI RAATTY 2 cut(s) 200, 212
Asp700I GAANNNNTTC 1 cut(s) 189
BanII GRGCYC 1 cut(s) 348
BbsI GAAGAC 2 cut(s) 57, 260
Bbv12I GWGCWC 1 cut(s) 348
BccI CCATC 4 cut(s) 126, 230, 280, 318
BcoDI GTCTC 3 cut(s) 76, 146, 280
BfaI CTAG 2 cut(s) 57, 122
BpiI GAAGAC 2 cut(s) 57, 260
BpmI CTGGAG 1 cut(s) 11
Bsa29I ATCGAT 1 cut(s) 309
BsaI GGTCTC 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 28
BseCI ATCGAT 1 cut(s) 309
BseGI GGATG 4 cut(s) 22, 246, 329, 384
BseNI ACTGG 1 cut(s) 28
BshVI ATCGAT 1 cut(s) 309
BsiHKAI GWGCWC 1 cut(s) 348
BsmAI GTCTC 3 cut(s) 76, 146, 280
BsmBI CGTCTC 1 cut(s) 280
Bso31I GGTCTC 1 cut(s) 76
Bsp1286I GDGCHC 1 cut(s) 348
Bsp143I GATC 2 cut(s) 228, 327
BspACI CCGC 1 cut(s) 145
BspDI ATCGAT 1 cut(s) 309
BspHI TCATGA 1 cut(s) 340
BspPI GGATC 1 cut(s) 335
BspTNI GGTCTC 1 cut(s) 76
BsrI ACTGG 1 cut(s) 28
BssMI GATC 2 cut(s) 228, 327
Bst4CI ACNGT 1 cut(s) 302
BstF5I GGATG 4 cut(s) 22, 246, 329, 384
BstKTI GATC 2 cut(s) 231, 330
BstMAI GTCTC 3 cut(s) 76, 146, 280
BstMBI GATC 2 cut(s) 228, 327
BstV2I GAAGAC 2 cut(s) 57, 260
Bsu15I ATCGAT 1 cut(s) 309
BsuTUI ATCGAT 1 cut(s) 309
BtsCI GGATG 4 cut(s) 22, 246, 329, 384
CciI TCATGA 1 cut(s) 340
ClaI ATCGAT 1 cut(s) 309
Csp6I GTAC 1 cut(s) 31
CviAII CATG 3 cut(s) 208, 341, 377
CviJI RGCY 3 cut(s) 64, 346, 356
CviKI_1 RGCY 3 cut(s) 64, 346, 356
CviQI GTAC 1 cut(s) 31
DpnI GATC 2 cut(s) 230, 329
DpnII GATC 2 cut(s) 228, 327
Ecl136II GAGCTC 1 cut(s) 346
Eco24I GRGCYC 1 cut(s) 348
Eco31I GGTCTC 1 cut(s) 76
Eco53kI GAGCTC 1 cut(s) 346
EcoICRI GAGCTC 1 cut(s) 346
EcoRI GAATTC 1 cut(s) 212
EcoT38I GRGCYC 1 cut(s) 348
Esp3I CGTCTC 1 cut(s) 280
FaeI CATG 3 cut(s) 211, 344, 380
FatI CATG 3 cut(s) 207, 340, 376
FauNDI CATATG 1 cut(s) 12
FokI GGATG 4 cut(s) 29, 253, 336, 371
FriOI GRGCYC 1 cut(s) 348
FspBI CTAG 2 cut(s) 57, 122
GsuI CTGGAG 1 cut(s) 11
Hin1II CATG 3 cut(s) 211, 344, 380
HinfI GANTC 5 cut(s) 4, 20, 104, 256, 306
Hpy188I TCNGA 1 cut(s) 184
Hpy188III TCNNGA 3 cut(s) 116, 170, 341
HpyAV CCTTC 1 cut(s) 54
HpyCH4III ACNGT 1 cut(s) 302
HpyCH4IV ACGT 1 cut(s) 96
HpyCH4V TGCA 1 cut(s) 281
HpySE526I ACGT 1 cut(s) 96
Hsp92II CATG 3 cut(s) 211, 344, 380
Kzo9I GATC 2 cut(s) 228, 327
LmnI GCTCC 2 cut(s) 30, 353
LpnPI CCDG 3 cut(s) 41, 122, 129
MaeI CTAG 2 cut(s) 57, 122
MaeII ACGT 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 101
MalI GATC 2 cut(s) 230, 329
MboI GATC 2 cut(s) 228, 327
MboII GAAGA 4 cut(s) 59, 62, 196, 265
MhlI GDGCHC 1 cut(s) 348
MluCI AATT 2 cut(s) 200, 212
MlyI GAGTC 2 cut(s) 98, 250
MroXI GAANNNNTTC 1 cut(s) 189
MseI TTAA 1 cut(s) 198
MslI CAYNNNNRTG 2 cut(s) 15, 389
NdeI CATATG 1 cut(s) 12
NdeII GATC 2 cut(s) 228, 327
NlaIII CATG 3 cut(s) 211, 344, 380
NmuCI GTSAC 1 cut(s) 101
PagI TCATGA 1 cut(s) 340
PdmI GAANNNNTTC 1 cut(s) 189
PfeI GAWTC 2 cut(s) 20, 306
PleI GAGTC 2 cut(s) 98, 250
PpsI GAGTC 2 cut(s) 98, 250
Psp124BI GAGCTC 1 cut(s) 348
RsaI GTAC 1 cut(s) 32
RsaNI GTAC 1 cut(s) 31
RseI CAYNNNNRTG 2 cut(s) 15, 389
SacI GAGCTC 1 cut(s) 348
SaqAI TTAA 1 cut(s) 198
Sau3AI GATC 2 cut(s) 228, 327
SchI GAGTC 2 cut(s) 98, 250
SduI GDGCHC 1 cut(s) 348
SetI ASST 5 cut(s) 99, 123, 338, 348, 358
SmiMI CAYNNNNRTG 2 cut(s) 15, 389
Sse9I AATT 2 cut(s) 200, 212
SsiI CCGC 1 cut(s) 145
SspMI CTAG 2 cut(s) 57, 122
SstI GAGCTC 1 cut(s) 348
TaaI ACNGT 1 cut(s) 302
TaiI ACGT 1 cut(s) 99
TaqI TCGA 3 cut(s) 78, 304, 309
TasI AATT 2 cut(s) 200, 212
TfiI GAWTC 2 cut(s) 20, 306
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 6 cut(s) 56, 60, 96, 196, 329, 374
TspGWI ACGGA 1 cut(s) 89
XapI RAATTY 2 cut(s) 200, 212
XmnI GAANNNNTTC 1 cut(s) 189
XspI CTAG 2 cut(s) 57, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.