Rmu_sc0002914.1_g000022

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002914.1
OG0015776
Physical Location & Seq
Forward (+)
100469 .. 100864
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002914.1_g000022.1.cds

Sequence Viewer

Length: 396 bp
atgaatgattcgctccagtacgagtatatgaatgaagaagaccccagaaggctgtgggtctcactcgaagaaagatttggcaacgtccgtgactccttgcttcctgacctagaagtgagatggcatagcctcggcttctgtgatttcaagtcatttcttgactataactcagaagcacttcgcattaaatccttaatggaattctgtggtaaagagatcacagatgcgatgttgattgagaagactctctctaccttccccgtctctgcattgatggttgctaagaactatcgaatttatgtaaatgcaagacggatcacaaggtttcatgagctcattggagctatgaatgtcgctgaaaagcatcacaatatccttgtgaagaactataattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

131

Amino Acids

15.51

Weight (kDa)

6.08

Isoelectric Point (pI)

54.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 323
AcsI RAATTY 2 cut(s) 200, 294
AfaI GTAC 1 cut(s) 20
AgsI TTSAA 1 cut(s) 148
AjuI GAANNNNNNNTTGG 2 cut(s) 60, 92
AluBI AGCT 2 cut(s) 334, 344
AluI AGCT 2 cut(s) 334, 344
Alw21I GWGCWC 1 cut(s) 336
Alw26I GTCTC 2 cut(s) 64, 268
AlwI GGATC 1 cut(s) 323
ApoI RAATTY 2 cut(s) 200, 294
Asp700I GAANNNNTTC 1 cut(s) 177
BanII GRGCYC 1 cut(s) 336
BbsI GAAGAC 2 cut(s) 45, 248
Bbv12I GWGCWC 1 cut(s) 336
BccI CCATC 2 cut(s) 114, 268
BcoDI GTCTC 2 cut(s) 64, 268
BfaI CTAG 1 cut(s) 110
BmsI GCATC 2 cut(s) 214, 373
BpiI GAAGAC 2 cut(s) 45, 248
BsaI GGTCTC 1 cut(s) 64
BsaJI CCNNGG 1 cut(s) 130
Bse1I ACTGG 1 cut(s) 16
BseDI CCNNGG 1 cut(s) 130
BseMII CTCAG 1 cut(s) 183
BseNI ACTGG 1 cut(s) 16
BsiHKAI GWGCWC 1 cut(s) 336
BsmAI GTCTC 2 cut(s) 64, 268
BsmBI CGTCTC 1 cut(s) 268
Bso31I GGTCTC 1 cut(s) 64
Bsp1286I GDGCHC 1 cut(s) 336
Bsp143I GATC 2 cut(s) 216, 315
BspCNI CTCAG 1 cut(s) 182
BspHI TCATGA 1 cut(s) 328
BspPI GGATC 1 cut(s) 323
BspTNI GGTCTC 1 cut(s) 64
BsrI ACTGG 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 130
BssMI GATC 2 cut(s) 216, 315
BstDEI CTNAG 2 cut(s) 169, 282
BstKTI GATC 2 cut(s) 219, 318
BstMAI GTCTC 2 cut(s) 64, 268
BstMBI GATC 2 cut(s) 216, 315
BstV2I GAAGAC 2 cut(s) 45, 248
BtgZI GCGATG 1 cut(s) 242
CciI TCATGA 1 cut(s) 328
Csp6I GTAC 1 cut(s) 19
CviAII CATG 1 cut(s) 329
CviJI RGCY 5 cut(s) 52, 129, 135, 334, 344
CviKI_1 RGCY 5 cut(s) 52, 129, 135, 334, 344
CviQI GTAC 1 cut(s) 19
DdeI CTNAG 2 cut(s) 169, 282
DpnI GATC 2 cut(s) 218, 317
DpnII GATC 2 cut(s) 216, 315
Ecl136II GAGCTC 1 cut(s) 334
Eco24I GRGCYC 1 cut(s) 336
Eco31I GGTCTC 1 cut(s) 64
Eco53kI GAGCTC 1 cut(s) 334
EcoICRI GAGCTC 1 cut(s) 334
EcoRI GAATTC 1 cut(s) 200
EcoT38I GRGCYC 1 cut(s) 336
Esp3I CGTCTC 1 cut(s) 268
FaeI CATG 1 cut(s) 332
FaiI YATR 8 cut(s) 27, 29, 126, 165, 300, 330, 347, 390
FatI CATG 1 cut(s) 328
FriOI GRGCYC 1 cut(s) 336
FspBI CTAG 1 cut(s) 110
Hin1II CATG 1 cut(s) 332
HinfI GANTC 3 cut(s) 8, 92, 244
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 3 cut(s) 104, 158, 329
HpyAV CCTTC 2 cut(s) 42, 265
HpyCH4IV ACGT 1 cut(s) 84
HpyCH4V TGCA 2 cut(s) 269, 308
HpyF3I CTNAG 2 cut(s) 169, 282
HpySE526I ACGT 1 cut(s) 84
Hsp92II CATG 1 cut(s) 332
Kzo9I GATC 2 cut(s) 216, 315
LmnI GCTCC 2 cut(s) 18, 341
LpnPI CCDG 3 cut(s) 29, 58, 117
LweI GCATC 2 cut(s) 214, 373
MaeI CTAG 1 cut(s) 110
MaeII ACGT 1 cut(s) 84
MaeIII GTNAC 1 cut(s) 89
MalI GATC 2 cut(s) 218, 317
MboI GATC 2 cut(s) 216, 315
MboII GAAGA 5 cut(s) 47, 50, 80, 253, 394
MhlI GDGCHC 1 cut(s) 336
MluCI AATT 3 cut(s) 200, 294, 391
MlyI GAGTC 2 cut(s) 86, 238
MnlI CCTC 1 cut(s) 140
MroXI GAANNNNTTC 1 cut(s) 177
MseI TTAA 2 cut(s) 186, 194
NdeII GATC 2 cut(s) 216, 315
NlaIII CATG 1 cut(s) 332
NmeAIII GCCGAG 1 cut(s) 111
NmuCI GTSAC 1 cut(s) 89
PagI TCATGA 1 cut(s) 328
PdmI GAANNNNTTC 1 cut(s) 177
PfeI GAWTC 1 cut(s) 8
PleI GAGTC 2 cut(s) 86, 238
PpsI GAGTC 2 cut(s) 86, 238
Psp124BI GAGCTC 1 cut(s) 336
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
SacI GAGCTC 1 cut(s) 336
SaqAI TTAA 2 cut(s) 186, 194
Sau3AI GATC 2 cut(s) 216, 315
SchI GAGTC 2 cut(s) 86, 238
SduI GDGCHC 1 cut(s) 336
SetI ASST 6 cut(s) 87, 111, 257, 326, 336, 346
SfaNI GCATC 2 cut(s) 214, 373
Sse9I AATT 3 cut(s) 200, 294, 391
SspMI CTAG 1 cut(s) 110
SstI GAGCTC 1 cut(s) 336
TaiI ACGT 1 cut(s) 87
TaqI TCGA 2 cut(s) 66, 292
TasI AATT 3 cut(s) 200, 294, 391
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 2 cut(s) 186, 194
Tru9I TTAA 2 cut(s) 186, 194
TseFI GTSAC 1 cut(s) 89
Tsp45I GTSAC 1 cut(s) 89
TspDTI ATGAA 5 cut(s) 17, 44, 48, 317, 362
TspGWI ACGGA 2 cut(s) 77, 328
XapI RAATTY 2 cut(s) 200, 294
XmnI GAANNNNTTC 1 cut(s) 177
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.