Rmu_sc0007727.1_g000007

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007727.1
OG0015776
Physical Location & Seq
Reverse (-)
30135 .. 30464
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007727.1_g000007.1.cds

Sequence Viewer

Length: 330 bp
atgtgggactcactcgaagtaaaatttggcaacgtccgtgactccctgcttcttgacctcgaagtgagatggcatagcctccgcttctgtgatttcaagtcagttcttgactataactcggaagcacttcgcattaattccttaatgaaattatgtggaaaaaagatcacaaatgcgatgttgattgagaagactctctctaccttcccggtctctgcattgatggttgctaagaactatcgaatcgatgttactgcaggacaaatcagaaggtttcatgagctcattggagctatgaatgttgctgaaaagcatgacaacatcttgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

109

Amino Acids

12.56

Weight (kDa)

8.64

Isoelectric Point (pI)

37.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 82
AcsI RAATTY 1 cut(s) 23
AgsI TTSAA 1 cut(s) 97
AjuI GAANNNNNNNTTGG 2 cut(s) 9, 41
AluBI AGCT 2 cut(s) 283, 293
AluI AGCT 2 cut(s) 283, 293
Alw21I GWGCWC 1 cut(s) 285
Alw26I GTCTC 1 cut(s) 217
ApoI RAATTY 1 cut(s) 23
AseI ATTAAT 1 cut(s) 135
Asp700I GAANNNNTTC 1 cut(s) 126
AsuC2I CCSGG 1 cut(s) 209
BanII GRGCYC 1 cut(s) 285
BbsI GAAGAC 1 cut(s) 197
Bbv12I GWGCWC 1 cut(s) 285
BccI CCATC 2 cut(s) 63, 217
BcgI CGANNNNNNTGC 2 cut(s) 236, 270
BcnI CCSGG 1 cut(s) 209
BcoDI GTCTC 1 cut(s) 217
BfmI CTRYAG 1 cut(s) 255
Bme1390I CCNGG 1 cut(s) 209
BmrFI CCNGG 1 cut(s) 209
BpiI GAAGAC 1 cut(s) 197
BpuMI CCSGG 1 cut(s) 209
Bsa29I ATCGAT 1 cut(s) 246
BsaI GGTCTC 1 cut(s) 217
BseCI ATCGAT 1 cut(s) 246
BshVI ATCGAT 1 cut(s) 246
BsiHKAI GWGCWC 1 cut(s) 285
BsiSI CCGG 1 cut(s) 209
BslFI GGGAC 1 cut(s) 20
BsmAI GTCTC 1 cut(s) 217
BsmFI GGGAC 1 cut(s) 20
Bso31I GGTCTC 1 cut(s) 217
Bsp1286I GDGCHC 1 cut(s) 285
Bsp143I GATC 1 cut(s) 165
BspACI CCGC 1 cut(s) 82
BspDI ATCGAT 1 cut(s) 246
BspHI TCATGA 1 cut(s) 277
BspMAI CTGCAG 1 cut(s) 259
BspTNI GGTCTC 1 cut(s) 217
BssMI GATC 1 cut(s) 165
BstDEI CTNAG 1 cut(s) 231
BstKTI GATC 1 cut(s) 168
BstMAI GTCTC 1 cut(s) 217
BstMBI GATC 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 207
BstSFI CTRYAG 1 cut(s) 255
BstV2I GAAGAC 1 cut(s) 197
Bsu15I ATCGAT 1 cut(s) 246
BsuTUI ATCGAT 1 cut(s) 246
BtgZI GCGATG 1 cut(s) 191
CciI TCATGA 1 cut(s) 277
ClaI ATCGAT 1 cut(s) 246
CviAII CATG 2 cut(s) 278, 314
CviJI RGCY 3 cut(s) 78, 283, 293
CviKI_1 RGCY 3 cut(s) 78, 283, 293
DdeI CTNAG 1 cut(s) 231
DpnI GATC 1 cut(s) 167
DpnII GATC 1 cut(s) 165
Ecl136II GAGCTC 1 cut(s) 283
Eco24I GRGCYC 1 cut(s) 285
Eco31I GGTCTC 1 cut(s) 217
Eco53kI GAGCTC 1 cut(s) 283
EcoICRI GAGCTC 1 cut(s) 283
EcoT38I GRGCYC 1 cut(s) 285
FaeI CATG 2 cut(s) 281, 317
FaiI YATR 6 cut(s) 75, 114, 154, 279, 296, 315
FaqI GGGAC 1 cut(s) 20
FatI CATG 2 cut(s) 277, 313
FriOI GRGCYC 1 cut(s) 285
HapII CCGG 1 cut(s) 209
Hin1II CATG 2 cut(s) 281, 317
HinfI GANTC 4 cut(s) 8, 41, 193, 243
HpaII CCGG 1 cut(s) 209
Hpy188I TCNGA 2 cut(s) 121, 269
Hpy188III TCNNGA 3 cut(s) 53, 107, 278
HpyAV CCTTC 2 cut(s) 214, 264
HpyCH4IV ACGT 1 cut(s) 33
HpyCH4V TGCA 2 cut(s) 218, 257
HpyF3I CTNAG 1 cut(s) 231
HpySE526I ACGT 1 cut(s) 33
Hsp92II CATG 2 cut(s) 281, 317
Kzo9I GATC 1 cut(s) 165
LmnI GCTCC 1 cut(s) 290
LpnPI CCDG 3 cut(s) 59, 222, 243
MaeII ACGT 1 cut(s) 33
MaeIII GTNAC 2 cut(s) 38, 250
MalI GATC 1 cut(s) 167
MboI GATC 1 cut(s) 165
MboII GAAGA 1 cut(s) 202
MhlI GDGCHC 1 cut(s) 285
MluCI AATT 3 cut(s) 23, 136, 149
MlyI GAGTC 3 cut(s) 2, 35, 187
MnlI CCTC 2 cut(s) 68, 89
MroXI GAANNNNTTC 1 cut(s) 126
MseI TTAA 2 cut(s) 135, 143
MspI CCGG 1 cut(s) 209
MspR9I CCNGG 1 cut(s) 209
NciI CCSGG 1 cut(s) 209
NdeII GATC 1 cut(s) 165
NlaIII CATG 2 cut(s) 281, 317
NmuCI GTSAC 1 cut(s) 38
PagI TCATGA 1 cut(s) 277
PdmI GAANNNNTTC 1 cut(s) 126
PfeI GAWTC 1 cut(s) 243
PleI GAGTC 3 cut(s) 2, 35, 187
PpsI GAGTC 3 cut(s) 2, 35, 187
PshBI ATTAAT 1 cut(s) 135
Psp124BI GAGCTC 1 cut(s) 285
PstI CTGCAG 1 cut(s) 259
SacI GAGCTC 1 cut(s) 285
SaqAI TTAA 2 cut(s) 135, 143
Sau3AI GATC 1 cut(s) 165
SchI GAGTC 3 cut(s) 2, 35, 187
ScrFI CCNGG 1 cut(s) 209
SduI GDGCHC 1 cut(s) 285
SetI ASST 6 cut(s) 36, 60, 206, 275, 285, 295
SfcI CTRYAG 1 cut(s) 255
Sse9I AATT 3 cut(s) 23, 136, 149
SsiI CCGC 1 cut(s) 82
SstI GAGCTC 1 cut(s) 285
StyD4I CCNGG 1 cut(s) 207
TaiI ACGT 1 cut(s) 36
TaqI TCGA 4 cut(s) 15, 60, 241, 246
TasI AATT 3 cut(s) 23, 136, 149
TfiI GAWTC 1 cut(s) 243
Tru1I TTAA 2 cut(s) 135, 143
Tru9I TTAA 2 cut(s) 135, 143
TseFI GTSAC 1 cut(s) 38
Tsp45I GTSAC 1 cut(s) 38
TspDTI ATGAA 3 cut(s) 161, 266, 311
TspGWI ACGGA 1 cut(s) 26
VspI ATTAAT 1 cut(s) 135
XapI RAATTY 1 cut(s) 23
XmnI GAANNNNTTC 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.