Rmu_sc0001136.1_g000022

Protein of unknown function (DUF707)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001136.1
Physical Location & Seq
Reverse (-)
80768 .. 87646
6879 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001136.1_g000022.1.cds

Sequence Viewer

Length: 1173 bp
atgatcaatcctgtgtctgtactgtcagatccgaagaatagatcattctactgcagtctcttcattgtagtttcattgatttccggtgcttatttcattggtagtgcgtccatttctcaggagtacaaggaaaaattaactagatggaaagttatctacaatatgcagaatacaaatcttggtacttgcaagaaacggtgccagccgtcggggactgaggcattaccggaaggaattgttgtcaaaacatcggacttggaaatgcggcctttatggggctcctctatgaaaaataaaaactcaatgccttcaatgagcttgctggctattgcagttggaataaaacagaaagaaatagtggacaaaattgttaggaagtttctatcaagtgattttgtggtaatgcttttccattatgatggtgctgtggataaatggagggacttaccttggagtgatactgccatacatgtatctgtgatgaaccaaacaaaatggtggttcgcaaaacgtttcttgcatccagatatagtgactgaatataaatatatttttctctgggatgaggacctcggagttgagaattttgatccagaacgatatctatcaattattcgggaagagggacttgaaatatcacagccagcacttgatcctgtcaaatcggaggtgtatcatccaatcactgcacgtgcaaagaaatcaaaagtgcacagaaggttttataagttcaaaggcagtggaaggtgcgatgatcaaagctctggtcctccatgtataggttgggtggaaatgatggcacctgtattctcaagtgcggcttggcaatgtgtatggtacatgattcagaatgacttgatccatgcatggggactggatgtgcagcttggttactgtgcacaaggggatcgaatgaaaaatgttggtgtggttgactcggaatatatagtacatcttggtcttcctacacttggtgtcgcagatgacaataagggtatcaatggcatggctcattctcacaaagagggctcaaaagcattggcaccgtctggcctccctcaagccagtaatagagctaaagttaggatgcagtccttcattgacatgcggatctttaaggaaagatggaggaatgcagtgaaggaggataaatgttgggttgacccatattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

390

Amino Acids

44.46

Weight (kDa)

8.82

Isoelectric Point (pI)

37.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 726
AccB1I GGYRCC 3 cut(s) 198, 799, 1042
AciI CCGC 3 cut(s) 265, 818, 1108
AclI AACGTT 1 cut(s) 511
AclWI GGATC 6 cut(s) 23, 584, 647, 853, 915, 1118
AcsI RAATTY 1 cut(s) 583
AcvI CACGTG 1 cut(s) 692
AdeI CACNNNGTG 1 cut(s) 974
AfaI GTAC 5 cut(s) 21, 125, 184, 839, 951
AfiI CCNNNNNNNGG 5 cut(s) 208, 275, 779, 868, 971
AflIII ACRYGT 1 cut(s) 469
AgsI TTSAA 3 cut(s) 312, 632, 733
AluBI AGCT 4 cut(s) 318, 762, 886, 1076
AluI AGCT 4 cut(s) 318, 762, 886, 1076
Alw21I GWGCWC 2 cut(s) 714, 901
Alw26I GTCTC 1 cut(s) 62
Alw44I GTGCAC 2 cut(s) 710, 897
AlwI GGATC 6 cut(s) 23, 584, 647, 853, 915, 1118
AoxI GGCC 2 cut(s) 266, 1051
ApaLI GTGCAC 2 cut(s) 710, 897
ApeKI GCWGC 1 cut(s) 883
ApoI RAATTY 1 cut(s) 583
ArsI GACNNNNNNTTYG 2 cut(s) 751, 783
AspS9I GGNCC 2 cut(s) 568, 767
AvaII GGWCC 2 cut(s) 568, 767
BaeGI GKGCMC 2 cut(s) 714, 901
BanI GGYRCC 3 cut(s) 198, 799, 1042
BanII GRGCYC 2 cut(s) 281, 1031
BbrPI CACGTG 1 cut(s) 692
BbsI GAAGAC 1 cut(s) 953
Bbv12I GWGCWC 2 cut(s) 714, 901
BbvI GCAGC 1 cut(s) 895
BccI CCATC 4 cut(s) 138, 413, 790, 1119
BceAI ACGGC 1 cut(s) 190
BclI TGATCA 2 cut(s) 3, 754
BcoDI GTCTC 1 cut(s) 62
BfaI CTAG 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 52
BisI GCNGC 3 cut(s) 266, 819, 884
BlsI GCNGC 3 cut(s) 267, 820, 885
Bme18I GGWCC 2 cut(s) 568, 767
BmgT120I GGNCC 2 cut(s) 568, 767
BmiI GGNNCC 4 cut(s) 200, 280, 801, 1044
BmsI GCATC 2 cut(s) 529, 1077
BpiI GAAGAC 1 cut(s) 953
BpuEI CTTGAG 2 cut(s) 796, 1044
BsaAI YACGTR 1 cut(s) 692
BsaBI GATNNNNATC 1 cut(s) 604
BsaJI CCNNGG 2 cut(s) 449, 571
BsaWI WCCGGW 2 cut(s) 83, 226
Bsc4I CCNNNNNNNGG 5 cut(s) 208, 275, 779, 868, 971
Bse1I ACTGG 2 cut(s) 879, 1065
Bse3DI GCAATG 1 cut(s) 833
Bse8I GATNNNNATC 1 cut(s) 604
BseDI CCNNGG 2 cut(s) 449, 571
BseGI GGATG 5 cut(s) 520, 568, 676, 883, 1092
BseJI GATNNNNATC 1 cut(s) 604
BseLI CCNNNNNNNGG 5 cut(s) 208, 275, 779, 868, 971
BseMI GCAATG 1 cut(s) 833
BseMII CTCAG 2 cut(s) 131, 207
BseNI ACTGG 2 cut(s) 879, 1065
BseRI GAGGAG 1 cut(s) 271
BseSI GKGCMC 2 cut(s) 714, 901
BseXI GCAGC 1 cut(s) 895
BsgI GTGCAG 2 cut(s) 672, 902
BshFI GGCC 2 cut(s) 268, 1053
BshNI GGYRCC 3 cut(s) 198, 799, 1042
BsiHKAI GWGCWC 2 cut(s) 714, 901
BsiSI CCGG 2 cut(s) 84, 227
BslFI GGGAC 4 cut(s) 226, 455, 639, 885
BslI CCNNNNNNNGG 5 cut(s) 208, 275, 779, 868, 971
BsmAI GTCTC 1 cut(s) 62
BsmFI GGGAC 4 cut(s) 226, 455, 639, 885
BsmI GAATGC 1 cut(s) 1138
BsnI GGCC 2 cut(s) 268, 1053
Bsp1286I GDGCHC 4 cut(s) 281, 714, 901, 1031
Bsp143I GATC 9 cut(s) 3, 28, 41, 589, 652, 754, 858, 907, 1110
BspACI CCGC 3 cut(s) 265, 818, 1108
BspANI GGCC 2 cut(s) 268, 1053
BspCNI CTCAG 2 cut(s) 130, 208
BspLI GGNNCC 4 cut(s) 200, 280, 801, 1044
BspMAI CTGCAG 1 cut(s) 56
BspPI GGATC 6 cut(s) 23, 584, 647, 853, 915, 1118
BspT107I GGYRCC 3 cut(s) 198, 799, 1042
BsrDI GCAATG 1 cut(s) 833
BsrI ACTGG 2 cut(s) 879, 1065
BssECI CCNNGG 2 cut(s) 449, 571
BssMI GATC 9 cut(s) 3, 28, 41, 589, 652, 754, 858, 907, 1110
BssT1I CCWWGG 1 cut(s) 449
Bst4CI ACNGT 4 cut(s) 24, 198, 896, 1047
Bst6I CTCTTC 2 cut(s) 65, 615
BstBAI YACGTR 1 cut(s) 692
BstC8I GCNNGC 4 cut(s) 203, 320, 324, 645
BstDEI CTNAG 2 cut(s) 117, 216
BstF5I GGATG 5 cut(s) 520, 568, 676, 883, 1092
BstKTI GATC 9 cut(s) 6, 31, 44, 592, 655, 757, 861, 910, 1113
BstMAI GTCTC 1 cut(s) 62
BstMBI GATC 9 cut(s) 3, 28, 41, 589, 652, 754, 858, 907, 1110
BstNSI RCATGY 2 cut(s) 473, 1108
BstSFI CTRYAG 1 cut(s) 52
BstSLI GKGCMC 2 cut(s) 714, 901
BstV1I GCAGC 1 cut(s) 895
BstV2I GAAGAC 1 cut(s) 953
BstX2I RGATCY 2 cut(s) 28, 1110
BstXI CCANNNNNNTGG 1 cut(s) 419
BstYI RGATCY 2 cut(s) 28, 1110
BsuRI GGCC 2 cut(s) 268, 1053
BtgZI GCGATG 1 cut(s) 765
BtsCI GGATG 5 cut(s) 520, 568, 676, 883, 1092
BtsI GCAGTG 3 cut(s) 684, 745, 1143
BtsIMutI CAGTG 3 cut(s) 684, 745, 1143
Cac8I GCNNGC 4 cut(s) 203, 320, 324, 645
Cfr13I GGNCC 2 cut(s) 568, 767
CseI GACGC 1 cut(s) 96
Csp6I GTAC 5 cut(s) 20, 124, 183, 838, 950
CspCI CAANNNNNGTGG 2 cut(s) 721, 756
CviAII CATG 7 cut(s) 470, 774, 841, 863, 867, 1006, 1105
CviQI GTAC 5 cut(s) 20, 124, 183, 838, 950
DdeI CTNAG 2 cut(s) 117, 216
DpnI GATC 9 cut(s) 5, 30, 43, 591, 654, 756, 860, 909, 1112
DpnII GATC 9 cut(s) 3, 28, 41, 589, 652, 754, 858, 907, 1110
DraIII CACNNNGTG 1 cut(s) 974
Eam1104I CTCTTC 2 cut(s) 65, 615
EarI CTCTTC 2 cut(s) 65, 615
Eco130I CCWWGG 1 cut(s) 449
Eco24I GRGCYC 2 cut(s) 281, 1031
Eco32I GATATC 1 cut(s) 602
Eco47I GGWCC 2 cut(s) 568, 767
Eco72I CACGTG 1 cut(s) 692
EcoO109I RGGNCCY 1 cut(s) 568
EcoRV GATATC 1 cut(s) 602
EcoT14I CCWWGG 1 cut(s) 449
EcoT22I ATGCAT 1 cut(s) 868
EcoT38I GRGCYC 2 cut(s) 281, 1031
ErhI CCWWGG 1 cut(s) 449
FaeI CATG 7 cut(s) 473, 777, 844, 866, 870, 1009, 1108
FalI AAGNNNNNCTT 4 cut(s) 612, 644, 805, 837
FaqI GGGAC 4 cut(s) 226, 455, 639, 885
FatI CATG 7 cut(s) 469, 773, 840, 862, 866, 1005, 1104
FbaI TGATCA 2 cut(s) 3, 754
Fnu4HI GCNGC 3 cut(s) 266, 819, 884
FokI GGATG 5 cut(s) 507, 575, 663, 890, 1099
FriOI GRGCYC 2 cut(s) 281, 1031
Fsp4HI GCNGC 3 cut(s) 266, 819, 884
FspBI CTAG 1 cut(s) 141
GluI GCNGC 3 cut(s) 266, 819, 884
HaeIII GGCC 2 cut(s) 268, 1053
HapII CCGG 2 cut(s) 84, 227
HgaI GACGC 1 cut(s) 96
Hin1II CATG 7 cut(s) 473, 777, 844, 866, 870, 1009, 1108
HincII GTYRAC 2 cut(s) 934, 1162
HindII GTYRAC 2 cut(s) 934, 1162
HinfI GANTC 2 cut(s) 844, 935
HpaII CCGG 2 cut(s) 84, 227
Hpy166II GTNNAC 5 cut(s) 361, 712, 899, 934, 1162
Hpy188I TCNGA 7 cut(s) 28, 33, 253, 575, 667, 849, 940
Hpy188III TCNNGA 4 cut(s) 119, 524, 593, 617
Hpy8I GTNNAC 5 cut(s) 361, 712, 899, 934, 1162
Hpy99I CGWCG 1 cut(s) 211
HpyAV CCTTC 6 cut(s) 224, 318, 711, 738, 1105, 1135
HpyCH4III ACNGT 4 cut(s) 24, 198, 896, 1047
HpyCH4IV ACGT 2 cut(s) 511, 691
HpyF3I CTNAG 2 cut(s) 117, 216
HpySE526I ACGT 2 cut(s) 511, 691
Hsp92II CATG 7 cut(s) 473, 777, 844, 866, 870, 1009, 1108
Ksp22I TGATCA 2 cut(s) 3, 754
Kzo9I GATC 9 cut(s) 3, 28, 41, 589, 652, 754, 858, 907, 1110
LmnI GCTCC 1 cut(s) 284
Lsp1109I GCAGC 1 cut(s) 895
LweI GCATC 2 cut(s) 529, 1077
MaeI CTAG 1 cut(s) 141
MaeII ACGT 2 cut(s) 511, 691
MaeIII GTNAC 2 cut(s) 532, 890
MalI GATC 9 cut(s) 5, 30, 43, 591, 654, 756, 860, 909, 1112
MboI GATC 9 cut(s) 3, 28, 41, 589, 652, 754, 858, 907, 1110
MboII GAAGA 4 cut(s) 46, 52, 632, 953
MflI RGATCY 2 cut(s) 28, 1110
MhlI GDGCHC 4 cut(s) 281, 714, 901, 1031
MluCI AATT 5 cut(s) 134, 234, 366, 583, 609
MlyI GAGTC 1 cut(s) 929
MmeI TCCRAC 1 cut(s) 316
Mph1103I ATGCAT 1 cut(s) 868
MseI TTAA 3 cut(s) 137, 1116, 1171
MslI CAYNNNNRTG 2 cut(s) 417, 1103
MspI CCGG 2 cut(s) 84, 227
Mva1269I GAATGC 1 cut(s) 1138
NdeII GATC 9 cut(s) 3, 28, 41, 589, 652, 754, 858, 907, 1110
NlaIII CATG 7 cut(s) 473, 777, 844, 866, 870, 1009, 1108
NlaIV GGNNCC 4 cut(s) 200, 280, 801, 1044
NmuCI GTSAC 1 cut(s) 532
NsiI ATGCAT 1 cut(s) 868
NspI RCATGY 2 cut(s) 473, 1108
PciI ACATGT 1 cut(s) 469
PctI GAATGC 1 cut(s) 1138
PfeI GAWTC 1 cut(s) 844
PkrI GCNGC 3 cut(s) 267, 820, 885
PleI GAGTC 1 cut(s) 929
PmaCI CACGTG 1 cut(s) 692
PmlI CACGTG 1 cut(s) 692
PpsI GAGTC 1 cut(s) 929
Ppu21I YACGTR 1 cut(s) 692
PpuMI RGGWCCY 1 cut(s) 568
PscI ACATGT 1 cut(s) 469
PsiI TTATAA 1 cut(s) 726
Psp1406I AACGTT 1 cut(s) 511
Psp5II RGGWCCY 1 cut(s) 568
PspCI CACGTG 1 cut(s) 692
PspN4I GGNNCC 4 cut(s) 200, 280, 801, 1044
PspPI GGNCC 2 cut(s) 568, 767
PspPPI RGGWCCY 1 cut(s) 568
PstI CTGCAG 1 cut(s) 56
PsuI RGATCY 2 cut(s) 28, 1110
RsaI GTAC 5 cut(s) 21, 125, 184, 839, 951
RsaNI GTAC 5 cut(s) 20, 124, 183, 838, 950
RseI CAYNNNNRTG 2 cut(s) 417, 1103
SaqAI TTAA 3 cut(s) 137, 1116, 1171
SatI GCNGC 3 cut(s) 266, 819, 884
Sau3AI GATC 9 cut(s) 3, 28, 41, 589, 652, 754, 858, 907, 1110
Sau96I GGNCC 2 cut(s) 568, 767
SchI GAGTC 1 cut(s) 929
SduI GDGCHC 4 cut(s) 281, 714, 901, 1031
SfaNI GCATC 2 cut(s) 529, 1077
SfcI CTRYAG 1 cut(s) 52
SinI GGWCC 2 cut(s) 568, 767
SmiMI CAYNNNNRTG 2 cut(s) 417, 1103
SmlI CTYRAG 2 cut(s) 811, 1059
SmoI CTYRAG 2 cut(s) 811, 1059
Sse9I AATT 5 cut(s) 134, 234, 366, 583, 609
SsiI CCGC 3 cut(s) 265, 818, 1108
SspMI CTAG 1 cut(s) 141
StyI CCWWGG 1 cut(s) 449
TaaI ACNGT 4 cut(s) 24, 198, 896, 1047
TaiI ACGT 2 cut(s) 514, 694
TaqI TCGA 1 cut(s) 910
TasI AATT 5 cut(s) 134, 234, 366, 583, 609
TatI WGTACW 3 cut(s) 19, 123, 949
TauI GCSGC 2 cut(s) 268, 821
TfiI GAWTC 1 cut(s) 844
Tru1I TTAA 3 cut(s) 137, 1116, 1171
Tru9I TTAA 3 cut(s) 137, 1116, 1171
TscAI CASTG 3 cut(s) 691, 745, 1143
TseFI GTSAC 1 cut(s) 532
TseI GCWGC 1 cut(s) 883
Tsp45I GTSAC 1 cut(s) 532
TspDTI ATGAA 7 cut(s) 52, 63, 85, 302, 497, 929, 1087
TspRI CASTG 3 cut(s) 691, 745, 1143
VneI GTGCAC 2 cut(s) 710, 897
VpaK11BI GGWCC 2 cut(s) 568, 767
XapI RAATTY 1 cut(s) 583
XceI RCATGY 2 cut(s) 473, 1108
XcmI CCANNNNNNNNNTGG 1 cut(s) 780
XspI CTAG 1 cut(s) 141
Zsp2I ATGCAT 1 cut(s) 868
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.