Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001136.1

Orthogroup ID

OG0004588

Physical Location & Seq

Genomic Coordinates Reverse (-)

80768 .. 87646

Gene Structure 6879 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001136.1_g000022.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1173 bp

atgatcaatcctgtgtctgtactgtcagatccgaagaatagatcattctactgcagtctcttcattgtagtttcattgatttccggtgcttatttcattggtagtgcgtccatttctcaggagtacaaggaaaaattaactagatggaaagttatctacaatatgcagaatacaaatcttggtacttgcaagaaacggtgccagccgtcggggactgaggcattaccggaaggaattgttgtcaaaacatcggacttggaaatgcggcctttatggggctcctctatgaaaaataaaaactcaatgccttcaatgagcttgctggctattgcagttggaataaaacagaaagaaatagtggacaaaattgttaggaagtttctatcaagtgattttgtggtaatgcttttccattatgatggtgctgtggataaatggagggacttaccttggagtgatactgccatacatgtatctgtgatgaaccaaacaaaatggtggttcgcaaaacgtttcttgcatccagatatagtgactgaatataaatatatttttctctgggatgaggacctcggagttgagaattttgatccagaacgatatctatcaattattcgggaagagggacttgaaatatcacagccagcacttgatcctgtcaaatcggaggtgtatcatccaatcactgcacgtgcaaagaaatcaaaagtgcacagaaggttttataagttcaaaggcagtggaaggtgcgatgatcaaagctctggtcctccatgtataggttgggtggaaatgatggcacctgtattctcaagtgcggcttggcaatgtgtatggtacatgattcagaatgacttgatccatgcatggggactggatgtgcagcttggttactgtgcacaaggggatcgaatgaaaaatgttggtgtggttgactcggaatatatagtacatcttggtcttcctacacttggtgtcgcagatgacaataagggtatcaatggcatggctcattctcacaaagagggctcaaaagcattggcaccgtctggcctccctcaagccagtaatagagctaaagttaggatgcagtccttcattgacatgcggatctttaaggaaagatggaggaatgcagtgaaggaggataaatgttgggttgacccatattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF707

Protein Analysis

390

Amino Acids

44.46

Weight (kDa)

8.82

Isoelectric Point (pI)

37.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004588)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G18530 AT4G18530 AT4G18530
fragaria_vesca	FvH4_5g28210 FvH4_5g28210 FvH4_5g28210
malus_domestica	MD08G1245700.v1.1 MD15G1440900.v1.1
prunus_persica	Prupe.1G583200_v2.0.a1 Prupe.1G583200_v2.0.a1 Prupe.1G583200_v2.0.a1 Prupe.1G583200_v2.0.a1 Prupe.1G583200_v2.0.a1 Prupe.1G583200_v2.0.a1 Prupe.1G583200_v2.0.a1 Prupe.1G583200_v2.0.a1 Prupe.1G583200_v2.0.a1 Prupe.1G583200_v2.0.a1
pyrus_communis	pycom08g21320 pycom15g38870
rosa_chinensis	RchiOBHm_Chr7g0220251
rosa_laevigata	RLG00000002246
rosa_multiflora	Rmu_sc0001136.1_g000022
rosa_roxburghii	Rroxscaffold_3G00239680
rosa_rugosa	Rorug07G0191500 Rorug07G0191600
rosa_samantha	Rh7AG333600 Rh7BG323600 Rh7CG351200 Rh7DG329900
rosa_wichuraiana	Rw7G028140

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	726
AccB1I	GGYRCC	3 cut(s)	198, 799, 1042
AciI	CCGC	3 cut(s)	265, 818, 1108
AclI	AACGTT	1 cut(s)	511
AclWI	GGATC	6 cut(s)	23, 584, 647, 853, 915, 1118
AcsI	RAATTY	1 cut(s)	583
AcvI	CACGTG	1 cut(s)	692
AdeI	CACNNNGTG	1 cut(s)	974
AfaI	GTAC	5 cut(s)	21, 125, 184, 839, 951
AfiI	CCNNNNNNNGG	5 cut(s)	208, 275, 779, 868, 971
AflIII	ACRYGT	1 cut(s)	469
AgsI	TTSAA	3 cut(s)	312, 632, 733
AluBI	AGCT	4 cut(s)	318, 762, 886, 1076
AluI	AGCT	4 cut(s)	318, 762, 886, 1076
Alw21I	GWGCWC	2 cut(s)	714, 901
Alw26I	GTCTC	1 cut(s)	62
Alw44I	GTGCAC	2 cut(s)	710, 897
AlwI	GGATC	6 cut(s)	23, 584, 647, 853, 915, 1118
AoxI	GGCC	2 cut(s)	266, 1051
ApaLI	GTGCAC	2 cut(s)	710, 897
ApeKI	GCWGC	1 cut(s)	883
ApoI	RAATTY	1 cut(s)	583
ArsI	GACNNNNNNTTYG	2 cut(s)	751, 783
AspS9I	GGNCC	2 cut(s)	568, 767
AvaII	GGWCC	2 cut(s)	568, 767
BaeGI	GKGCMC	2 cut(s)	714, 901
BanI	GGYRCC	3 cut(s)	198, 799, 1042
BanII	GRGCYC	2 cut(s)	281, 1031
BbrPI	CACGTG	1 cut(s)	692
BbsI	GAAGAC	1 cut(s)	953
Bbv12I	GWGCWC	2 cut(s)	714, 901
BbvI	GCAGC	1 cut(s)	895
BccI	CCATC	4 cut(s)	138, 413, 790, 1119
BceAI	ACGGC	1 cut(s)	190
BclI	TGATCA	2 cut(s)	3, 754
BcoDI	GTCTC	1 cut(s)	62
BfaI	CTAG	1 cut(s)	141
BfmI	CTRYAG	1 cut(s)	52
BisI	GCNGC	3 cut(s)	266, 819, 884
BlsI	GCNGC	3 cut(s)	267, 820, 885
Bme18I	GGWCC	2 cut(s)	568, 767
BmgT120I	GGNCC	2 cut(s)	568, 767
BmiI	GGNNCC	4 cut(s)	200, 280, 801, 1044
BmsI	GCATC	2 cut(s)	529, 1077
BpiI	GAAGAC	1 cut(s)	953
BpuEI	CTTGAG	2 cut(s)	796, 1044
BsaAI	YACGTR	1 cut(s)	692
BsaBI	GATNNNNATC	1 cut(s)	604
BsaJI	CCNNGG	2 cut(s)	449, 571
BsaWI	WCCGGW	2 cut(s)	83, 226
Bsc4I	CCNNNNNNNGG	5 cut(s)	208, 275, 779, 868, 971
Bse1I	ACTGG	2 cut(s)	879, 1065
Bse3DI	GCAATG	1 cut(s)	833
Bse8I	GATNNNNATC	1 cut(s)	604
BseDI	CCNNGG	2 cut(s)	449, 571
BseGI	GGATG	5 cut(s)	520, 568, 676, 883, 1092
BseJI	GATNNNNATC	1 cut(s)	604
BseLI	CCNNNNNNNGG	5 cut(s)	208, 275, 779, 868, 971
BseMI	GCAATG	1 cut(s)	833
BseMII	CTCAG	2 cut(s)	131, 207
BseNI	ACTGG	2 cut(s)	879, 1065
BseRI	GAGGAG	1 cut(s)	271
BseSI	GKGCMC	2 cut(s)	714, 901
BseXI	GCAGC	1 cut(s)	895
BsgI	GTGCAG	2 cut(s)	672, 902
BshFI	GGCC	2 cut(s)	268, 1053
BshNI	GGYRCC	3 cut(s)	198, 799, 1042
BsiHKAI	GWGCWC	2 cut(s)	714, 901
BsiSI	CCGG	2 cut(s)	84, 227
BslFI	GGGAC	4 cut(s)	226, 455, 639, 885
BslI	CCNNNNNNNGG	5 cut(s)	208, 275, 779, 868, 971
BsmAI	GTCTC	1 cut(s)	62
BsmFI	GGGAC	4 cut(s)	226, 455, 639, 885
BsmI	GAATGC	1 cut(s)	1138
BsnI	GGCC	2 cut(s)	268, 1053
Bsp1286I	GDGCHC	4 cut(s)	281, 714, 901, 1031
Bsp143I	GATC	9 cut(s)	3, 28, 41, 589, 652, 754, 858, 907, 1110
BspACI	CCGC	3 cut(s)	265, 818, 1108
BspANI	GGCC	2 cut(s)	268, 1053
BspCNI	CTCAG	2 cut(s)	130, 208
BspLI	GGNNCC	4 cut(s)	200, 280, 801, 1044
BspMAI	CTGCAG	1 cut(s)	56
BspPI	GGATC	6 cut(s)	23, 584, 647, 853, 915, 1118
BspT107I	GGYRCC	3 cut(s)	198, 799, 1042
BsrDI	GCAATG	1 cut(s)	833
BsrI	ACTGG	2 cut(s)	879, 1065
BssECI	CCNNGG	2 cut(s)	449, 571
BssMI	GATC	9 cut(s)	3, 28, 41, 589, 652, 754, 858, 907, 1110
BssT1I	CCWWGG	1 cut(s)	449
Bst4CI	ACNGT	4 cut(s)	24, 198, 896, 1047
Bst6I	CTCTTC	2 cut(s)	65, 615
BstBAI	YACGTR	1 cut(s)	692
BstC8I	GCNNGC	4 cut(s)	203, 320, 324, 645
BstDEI	CTNAG	2 cut(s)	117, 216
BstF5I	GGATG	5 cut(s)	520, 568, 676, 883, 1092
BstKTI	GATC	9 cut(s)	6, 31, 44, 592, 655, 757, 861, 910, 1113
BstMAI	GTCTC	1 cut(s)	62
BstMBI	GATC	9 cut(s)	3, 28, 41, 589, 652, 754, 858, 907, 1110
BstNSI	RCATGY	2 cut(s)	473, 1108
BstSFI	CTRYAG	1 cut(s)	52
BstSLI	GKGCMC	2 cut(s)	714, 901
BstV1I	GCAGC	1 cut(s)	895
BstV2I	GAAGAC	1 cut(s)	953
BstX2I	RGATCY	2 cut(s)	28, 1110
BstXI	CCANNNNNNTGG	1 cut(s)	419
BstYI	RGATCY	2 cut(s)	28, 1110
BsuRI	GGCC	2 cut(s)	268, 1053
BtgZI	GCGATG	1 cut(s)	765
BtsCI	GGATG	5 cut(s)	520, 568, 676, 883, 1092
BtsI	GCAGTG	3 cut(s)	684, 745, 1143
BtsIMutI	CAGTG	3 cut(s)	684, 745, 1143
Cac8I	GCNNGC	4 cut(s)	203, 320, 324, 645
Cfr13I	GGNCC	2 cut(s)	568, 767
CseI	GACGC	1 cut(s)	96
Csp6I	GTAC	5 cut(s)	20, 124, 183, 838, 950
CspCI	CAANNNNNGTGG	2 cut(s)	721, 756
CviAII	CATG	7 cut(s)	470, 774, 841, 863, 867, 1006, 1105
CviQI	GTAC	5 cut(s)	20, 124, 183, 838, 950
DdeI	CTNAG	2 cut(s)	117, 216
DpnI	GATC	9 cut(s)	5, 30, 43, 591, 654, 756, 860, 909, 1112
DpnII	GATC	9 cut(s)	3, 28, 41, 589, 652, 754, 858, 907, 1110
DraIII	CACNNNGTG	1 cut(s)	974
Eam1104I	CTCTTC	2 cut(s)	65, 615
EarI	CTCTTC	2 cut(s)	65, 615
Eco130I	CCWWGG	1 cut(s)	449
Eco24I	GRGCYC	2 cut(s)	281, 1031
Eco32I	GATATC	1 cut(s)	602
Eco47I	GGWCC	2 cut(s)	568, 767
Eco72I	CACGTG	1 cut(s)	692
EcoO109I	RGGNCCY	1 cut(s)	568
EcoRV	GATATC	1 cut(s)	602
EcoT14I	CCWWGG	1 cut(s)	449
EcoT22I	ATGCAT	1 cut(s)	868
EcoT38I	GRGCYC	2 cut(s)	281, 1031
ErhI	CCWWGG	1 cut(s)	449
FaeI	CATG	7 cut(s)	473, 777, 844, 866, 870, 1009, 1108
FalI	AAGNNNNNCTT	4 cut(s)	612, 644, 805, 837
FaqI	GGGAC	4 cut(s)	226, 455, 639, 885
FatI	CATG	7 cut(s)	469, 773, 840, 862, 866, 1005, 1104
FbaI	TGATCA	2 cut(s)	3, 754
Fnu4HI	GCNGC	3 cut(s)	266, 819, 884
FokI	GGATG	5 cut(s)	507, 575, 663, 890, 1099
FriOI	GRGCYC	2 cut(s)	281, 1031
Fsp4HI	GCNGC	3 cut(s)	266, 819, 884
FspBI	CTAG	1 cut(s)	141
GluI	GCNGC	3 cut(s)	266, 819, 884
HaeIII	GGCC	2 cut(s)	268, 1053
HapII	CCGG	2 cut(s)	84, 227
HgaI	GACGC	1 cut(s)	96
Hin1II	CATG	7 cut(s)	473, 777, 844, 866, 870, 1009, 1108
HincII	GTYRAC	2 cut(s)	934, 1162
HindII	GTYRAC	2 cut(s)	934, 1162
HinfI	GANTC	2 cut(s)	844, 935
HpaII	CCGG	2 cut(s)	84, 227
Hpy166II	GTNNAC	5 cut(s)	361, 712, 899, 934, 1162
Hpy188I	TCNGA	7 cut(s)	28, 33, 253, 575, 667, 849, 940
Hpy188III	TCNNGA	4 cut(s)	119, 524, 593, 617
Hpy8I	GTNNAC	5 cut(s)	361, 712, 899, 934, 1162
Hpy99I	CGWCG	1 cut(s)	211
HpyAV	CCTTC	6 cut(s)	224, 318, 711, 738, 1105, 1135
HpyCH4III	ACNGT	4 cut(s)	24, 198, 896, 1047
HpyCH4IV	ACGT	2 cut(s)	511, 691
HpyF3I	CTNAG	2 cut(s)	117, 216
HpySE526I	ACGT	2 cut(s)	511, 691
Hsp92II	CATG	7 cut(s)	473, 777, 844, 866, 870, 1009, 1108
Ksp22I	TGATCA	2 cut(s)	3, 754
Kzo9I	GATC	9 cut(s)	3, 28, 41, 589, 652, 754, 858, 907, 1110
LmnI	GCTCC	1 cut(s)	284
Lsp1109I	GCAGC	1 cut(s)	895
LweI	GCATC	2 cut(s)	529, 1077
MaeI	CTAG	1 cut(s)	141
MaeII	ACGT	2 cut(s)	511, 691
MaeIII	GTNAC	2 cut(s)	532, 890
MalI	GATC	9 cut(s)	5, 30, 43, 591, 654, 756, 860, 909, 1112
MboI	GATC	9 cut(s)	3, 28, 41, 589, 652, 754, 858, 907, 1110
MboII	GAAGA	4 cut(s)	46, 52, 632, 953
MflI	RGATCY	2 cut(s)	28, 1110
MhlI	GDGCHC	4 cut(s)	281, 714, 901, 1031
MluCI	AATT	5 cut(s)	134, 234, 366, 583, 609
MlyI	GAGTC	1 cut(s)	929
MmeI	TCCRAC	1 cut(s)	316
Mph1103I	ATGCAT	1 cut(s)	868
MseI	TTAA	3 cut(s)	137, 1116, 1171
MslI	CAYNNNNRTG	2 cut(s)	417, 1103
MspI	CCGG	2 cut(s)	84, 227
Mva1269I	GAATGC	1 cut(s)	1138
NdeII	GATC	9 cut(s)	3, 28, 41, 589, 652, 754, 858, 907, 1110
NlaIII	CATG	7 cut(s)	473, 777, 844, 866, 870, 1009, 1108
NlaIV	GGNNCC	4 cut(s)	200, 280, 801, 1044
NmuCI	GTSAC	1 cut(s)	532
NsiI	ATGCAT	1 cut(s)	868
NspI	RCATGY	2 cut(s)	473, 1108
PciI	ACATGT	1 cut(s)	469
PctI	GAATGC	1 cut(s)	1138
PfeI	GAWTC	1 cut(s)	844
PkrI	GCNGC	3 cut(s)	267, 820, 885
PleI	GAGTC	1 cut(s)	929
PmaCI	CACGTG	1 cut(s)	692
PmlI	CACGTG	1 cut(s)	692
PpsI	GAGTC	1 cut(s)	929
Ppu21I	YACGTR	1 cut(s)	692
PpuMI	RGGWCCY	1 cut(s)	568
PscI	ACATGT	1 cut(s)	469
PsiI	TTATAA	1 cut(s)	726
Psp1406I	AACGTT	1 cut(s)	511
Psp5II	RGGWCCY	1 cut(s)	568
PspCI	CACGTG	1 cut(s)	692
PspN4I	GGNNCC	4 cut(s)	200, 280, 801, 1044
PspPI	GGNCC	2 cut(s)	568, 767
PspPPI	RGGWCCY	1 cut(s)	568
PstI	CTGCAG	1 cut(s)	56
PsuI	RGATCY	2 cut(s)	28, 1110
RsaI	GTAC	5 cut(s)	21, 125, 184, 839, 951
RsaNI	GTAC	5 cut(s)	20, 124, 183, 838, 950
RseI	CAYNNNNRTG	2 cut(s)	417, 1103
SaqAI	TTAA	3 cut(s)	137, 1116, 1171
SatI	GCNGC	3 cut(s)	266, 819, 884
Sau3AI	GATC	9 cut(s)	3, 28, 41, 589, 652, 754, 858, 907, 1110
Sau96I	GGNCC	2 cut(s)	568, 767
SchI	GAGTC	1 cut(s)	929
SduI	GDGCHC	4 cut(s)	281, 714, 901, 1031
SfaNI	GCATC	2 cut(s)	529, 1077
SfcI	CTRYAG	1 cut(s)	52
SinI	GGWCC	2 cut(s)	568, 767
SmiMI	CAYNNNNRTG	2 cut(s)	417, 1103
SmlI	CTYRAG	2 cut(s)	811, 1059
SmoI	CTYRAG	2 cut(s)	811, 1059
Sse9I	AATT	5 cut(s)	134, 234, 366, 583, 609
SsiI	CCGC	3 cut(s)	265, 818, 1108
SspMI	CTAG	1 cut(s)	141
StyI	CCWWGG	1 cut(s)	449
TaaI	ACNGT	4 cut(s)	24, 198, 896, 1047
TaiI	ACGT	2 cut(s)	514, 694
TaqI	TCGA	1 cut(s)	910
TasI	AATT	5 cut(s)	134, 234, 366, 583, 609
TatI	WGTACW	3 cut(s)	19, 123, 949
TauI	GCSGC	2 cut(s)	268, 821
TfiI	GAWTC	1 cut(s)	844
Tru1I	TTAA	3 cut(s)	137, 1116, 1171
Tru9I	TTAA	3 cut(s)	137, 1116, 1171
TscAI	CASTG	3 cut(s)	691, 745, 1143
TseFI	GTSAC	1 cut(s)	532
TseI	GCWGC	1 cut(s)	883
Tsp45I	GTSAC	1 cut(s)	532
TspDTI	ATGAA	7 cut(s)	52, 63, 85, 302, 497, 929, 1087
TspRI	CASTG	3 cut(s)	691, 745, 1143
VneI	GTGCAC	2 cut(s)	710, 897
VpaK11BI	GGWCC	2 cut(s)	568, 767
XapI	RAATTY	1 cut(s)	583
XceI	RCATGY	2 cut(s)	473, 1108
XcmI	CCANNNNNNNNNTGG	1 cut(s)	780
XspI	CTAG	1 cut(s)	141
Zsp2I	ATGCAT	1 cut(s)	868

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.