Rmu_sc0001144.1_g000002
MADS Family

MADS-box protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001144.1
Physical Location & Seq
Forward (+)
8851 .. 10729
1879 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001144.1_g000002.1.cds

Sequence Viewer

Length: 462 bp
atgcagacaactattgaacgttatgagaagcatgcaaaagacaaccaagccaacaaatctgttgccagtgaacaaaatgtgcagcagctcaagcatgaagcaactagcatgatgaagcagatagagcatcttgaagtttcgaaacggaaactattgggagagagtctaggactatgcagcattgacgaactgcaagaaatagagcaacagttggagaggagtgtgaacagcattcgagcaaggaaggcacaggtttacaaggaacagattgagcaattgagagaaaaggaaagagtcctcacagctgaaaatcagaggctaaatgagaagtgtgaggctatgcaaccgaggcaaccagtaagtgagcagagagaaaacttagcctgccctgaaagtagtccaagttcagatgttgagactgaattgttcattggactgccagaaagaagatcgaagcactag
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

153

Amino Acids

17.77

Weight (kDa)

5.89

Isoelectric Point (pI)

69.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 19
AgsI TTSAA 2 cut(s) 17, 134
AjuI GAANNNNNNNTTGG 2 cut(s) 414, 446
AluBI AGCT 2 cut(s) 88, 305
AluI AGCT 2 cut(s) 88, 305
Alw26I GTCTC 1 cut(s) 410
ApeKI GCWGC 3 cut(s) 82, 85, 177
AsuII TTCGAA 1 cut(s) 140
BbvI GCAGC 3 cut(s) 94, 97, 189
BcoDI GTCTC 1 cut(s) 410
BfaI CTAG 3 cut(s) 105, 167, 460
BisI GCNGC 3 cut(s) 83, 86, 178
BlsI GCNGC 3 cut(s) 84, 87, 179
BmsI GCATC 1 cut(s) 136
Bpu14I TTCGAA 1 cut(s) 140
BpuEI CTTGAG 1 cut(s) 74
BsaJI CCNNGG 1 cut(s) 347
Bse1I ACTGG 2 cut(s) 66, 356
BseDI CCNNGG 1 cut(s) 347
BseNI ACTGG 2 cut(s) 66, 356
BseRI GAGGAG 1 cut(s) 232
BseXI GCAGC 3 cut(s) 94, 97, 189
BsgI GTGCAG 1 cut(s) 101
BsmAI GTCTC 1 cut(s) 410
BsmI GAATGC 1 cut(s) 231
Bsp119I TTCGAA 1 cut(s) 140
Bsp143I GATC 1 cut(s) 449
BspT104I TTCGAA 1 cut(s) 140
BsrI ACTGG 2 cut(s) 66, 356
BssECI CCNNGG 1 cut(s) 347
BssMI GATC 1 cut(s) 449
Bst4CI ACNGT 1 cut(s) 210
BstBI TTCGAA 1 cut(s) 140
BstC8I GCNNGC 2 cut(s) 33, 385
BstDEI CTNAG 1 cut(s) 379
BstKTI GATC 1 cut(s) 452
BstMAI GTCTC 1 cut(s) 410
BstMBI GATC 1 cut(s) 449
BstMWI GCNNNNNNNGC 4 cut(s) 91, 124, 245, 349
BstNSI RCATGY 1 cut(s) 35
BstV1I GCAGC 3 cut(s) 94, 97, 189
BtsIMutI CAGTG 1 cut(s) 73
Cac8I GCNNGC 2 cut(s) 33, 385
CviAII CATG 3 cut(s) 32, 95, 109
CviJI RGCY 6 cut(s) 50, 88, 305, 319, 338, 383
CviKI_1 RGCY 6 cut(s) 50, 88, 305, 319, 338, 383
DdeI CTNAG 1 cut(s) 379
DpnI GATC 1 cut(s) 451
DpnII GATC 1 cut(s) 449
FaeI CATG 3 cut(s) 35, 98, 112
FaiI YATR 6 cut(s) 24, 33, 96, 110, 175, 341
FatI CATG 3 cut(s) 31, 94, 108
Fnu4HI GCNGC 3 cut(s) 83, 86, 178
Fsp4HI GCNGC 3 cut(s) 83, 86, 178
FspBI CTAG 3 cut(s) 105, 167, 460
GluI GCNGC 3 cut(s) 83, 86, 178
Hin1II CATG 3 cut(s) 35, 98, 112
HinfI GANTC 2 cut(s) 163, 294
Hpy166II GTNNAC 3 cut(s) 71, 226, 256
Hpy188I TCNGA 2 cut(s) 315, 409
Hpy188III TCNNGA 1 cut(s) 131
Hpy8I GTNNAC 3 cut(s) 71, 226, 256
HpyAV CCTTC 1 cut(s) 238
HpyCH4III ACNGT 1 cut(s) 210
HpyCH4IV ACGT 1 cut(s) 19
HpyCH4V TGCA 6 cut(s) 4, 35, 82, 177, 193, 343
HpyF10VI GCNNNNNNNGC 4 cut(s) 91, 124, 245, 349
HpyF3I CTNAG 1 cut(s) 379
HpySE526I ACGT 1 cut(s) 19
Hsp92II CATG 3 cut(s) 35, 98, 112
Kzo9I GATC 1 cut(s) 449
LpnPI CCDG 6 cut(s) 79, 236, 369, 397, 402, 453
Lsp1109I GCAGC 3 cut(s) 94, 97, 189
LweI GCATC 1 cut(s) 136
MaeI CTAG 3 cut(s) 105, 167, 460
MaeII ACGT 1 cut(s) 19
MalI GATC 1 cut(s) 451
MboI GATC 1 cut(s) 449
MboII GAAGA 1 cut(s) 459
MfeI CAATTG 1 cut(s) 275
MluCI AATT 2 cut(s) 275, 422
MlyI GAGTC 2 cut(s) 172, 303
MmeI TCCRAC 1 cut(s) 192
MnlI CCTC 5 cut(s) 210, 308, 309, 328, 342
MspA1I CMGCKG 1 cut(s) 305
MunI CAATTG 1 cut(s) 275
Mva1269I GAATGC 1 cut(s) 231
MwoI GCNNNNNNNGC 4 cut(s) 91, 124, 245, 349
NdeII GATC 1 cut(s) 449
NlaIII CATG 3 cut(s) 35, 98, 112
NspI RCATGY 1 cut(s) 35
NspV TTCGAA 1 cut(s) 140
PaeI GCATGC 1 cut(s) 35
PctI GAATGC 1 cut(s) 231
PkrI GCNGC 3 cut(s) 84, 87, 179
PleI GAGTC 2 cut(s) 171, 302
PpsI GAGTC 2 cut(s) 171, 302
Psp1406I AACGTT 1 cut(s) 19
PsrI GAACNNNNNNTAC 2 cut(s) 388, 420
PvuII CAGCTG 1 cut(s) 305
SatI GCNGC 3 cut(s) 83, 86, 178
Sau3AI GATC 1 cut(s) 449
SchI GAGTC 2 cut(s) 172, 303
SetI ASST 4 cut(s) 22, 90, 255, 307
SfaNI GCATC 1 cut(s) 136
SfuI TTCGAA 1 cut(s) 140
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
SphI GCATGC 1 cut(s) 35
Sse9I AATT 2 cut(s) 275, 422
SspMI CTAG 3 cut(s) 105, 167, 460
TaaI ACNGT 1 cut(s) 210
TaiI ACGT 1 cut(s) 22
TaqI TCGA 3 cut(s) 140, 235, 452
TasI AATT 2 cut(s) 275, 422
TscAI CASTG 1 cut(s) 73
TseI GCWGC 3 cut(s) 82, 85, 177
TspDTI ATGAA 3 cut(s) 111, 128, 418
TspGWI ACGGA 1 cut(s) 160
TspRI CASTG 1 cut(s) 73
XceI RCATGY 1 cut(s) 35
XspI CTAG 3 cut(s) 105, 167, 460
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.