Rmu_sc0001144.1_g000028

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001144.1
OG0016469
Physical Location & Seq
Reverse (-)
100476 .. 100751
276 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 276 bp
atgatgatgtctgccgctaccttgcaaatccaaactctggaagatgaggaatcacaatggggtggttcttcagaaggtcgtaactataaggccagggatcgagagcttatggatcttcgactccaagctcaatacttcactgatccatgcaggtatgaaccaaatatagaatgcaaccttggggtctttgacaggatgaggcacgacatggctaactgcgactcatattttgttcagagaagagatgctagtggaagagtcgacttatccacttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

91

Amino Acids

10.62

Weight (kDa)

4.73

Isoelectric Point (pI)

63.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 141
AccB7I CCANNNNNTGG 1 cut(s) 37
AccI GTMKAC 1 cut(s) 261
AciI CCGC 1 cut(s) 15
AclWI GGATC 3 cut(s) 105, 120, 137
AcuI CTGAAG 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 37
AjnI CCWGG 1 cut(s) 92
AjuI GAANNNNNNNTTGG 2 cut(s) 162, 194
AluBI AGCT 2 cut(s) 106, 128
AluI AGCT 2 cut(s) 106, 128
AlwI GGATC 3 cut(s) 105, 120, 137
AoxI GGCC 1 cut(s) 90
ArsI GACNNNNNNTTYG 2 cut(s) 212, 244
BciT130I CCWGG 1 cut(s) 94
BfaI CTAG 1 cut(s) 249
BfuAI ACCTGC 1 cut(s) 141
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
Bme1390I CCNGG 1 cut(s) 94
BmrFI CCNGG 1 cut(s) 94
BmsI GCATC 1 cut(s) 235
BsaJI CCNNGG 2 cut(s) 93, 178
Bsc4I CCNNNNNNNGG 1 cut(s) 37
BseBI CCWGG 1 cut(s) 94
BseDI CCNNGG 2 cut(s) 93, 178
BseGI GGATG 1 cut(s) 201
BseLI CCNNNNNNNGG 1 cut(s) 37
BshFI GGCC 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 37
BsmI GAATGC 1 cut(s) 176
BsnI GGCC 1 cut(s) 92
Bsp143I GATC 3 cut(s) 97, 112, 142
BspACI CCGC 1 cut(s) 15
BspANI GGCC 1 cut(s) 92
BspMI ACCTGC 1 cut(s) 141
BspPI GGATC 3 cut(s) 105, 120, 137
BssECI CCNNGG 2 cut(s) 93, 178
BssMI GATC 3 cut(s) 97, 112, 142
BssT1I CCWWGG 1 cut(s) 178
Bst2UI CCWGG 1 cut(s) 94
Bst6I CTCTTC 2 cut(s) 235, 250
BstF5I GGATG 1 cut(s) 201
BstKTI GATC 3 cut(s) 100, 115, 145
BstMBI GATC 3 cut(s) 97, 112, 142
BstNI CCWGG 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 92
BstX2I RGATCY 1 cut(s) 112
BstYI RGATCY 1 cut(s) 112
BsuRI GGCC 1 cut(s) 92
BtsCI GGATG 1 cut(s) 201
BtsIMutI CAGTG 1 cut(s) 138
BveI ACCTGC 1 cut(s) 141
CviAII CATG 2 cut(s) 147, 208
CviJI RGCY 4 cut(s) 92, 106, 128, 212
CviKI_1 RGCY 4 cut(s) 92, 106, 128, 212
DpnI GATC 3 cut(s) 99, 114, 144
DpnII GATC 3 cut(s) 97, 112, 142
Eam1104I CTCTTC 2 cut(s) 235, 250
EarI CTCTTC 2 cut(s) 235, 250
Eco130I CCWWGG 1 cut(s) 178
Eco57I CTGAAG 1 cut(s) 54
EcoRII CCWGG 1 cut(s) 92
EcoT14I CCWWGG 1 cut(s) 178
ErhI CCWWGG 1 cut(s) 178
FaeI CATG 2 cut(s) 150, 211
FaiI YATR 7 cut(s) 87, 110, 148, 156, 167, 209, 226
FatI CATG 2 cut(s) 146, 207
FblI GTMKAC 1 cut(s) 261
Fnu4HI GCNGC 1 cut(s) 15
FokI GGATG 1 cut(s) 208
Fsp4HI GCNGC 1 cut(s) 15
FspBI CTAG 1 cut(s) 249
GluI GCNGC 1 cut(s) 15
HaeIII GGCC 1 cut(s) 92
Hin1II CATG 2 cut(s) 150, 211
HincII GTYRAC 1 cut(s) 262
HindII GTYRAC 1 cut(s) 262
HinfI GANTC 4 cut(s) 50, 120, 221, 258
Hpy166II GTNNAC 1 cut(s) 262
Hpy188I TCNGA 2 cut(s) 73, 237
Hpy188III TCNNGA 2 cut(s) 38, 101
Hpy8I GTNNAC 1 cut(s) 262
HpyAV CCTTC 1 cut(s) 68
HpyCH4V TGCA 3 cut(s) 25, 150, 174
Hsp92II CATG 2 cut(s) 150, 211
Kzo9I GATC 3 cut(s) 97, 112, 142
LpnPI CCDG 5 cut(s) 23, 79, 106, 136, 178
LweI GCATC 1 cut(s) 235
MaeI CTAG 1 cut(s) 249
MaeIII GTNAC 1 cut(s) 80
MalI GATC 3 cut(s) 99, 114, 144
MboI GATC 3 cut(s) 97, 112, 142
MboII GAAGA 5 cut(s) 53, 60, 107, 252, 267
MflI RGATCY 1 cut(s) 112
MlyI GAGTC 3 cut(s) 114, 215, 267
MnlI CCTC 2 cut(s) 40, 192
MseI TTAA 1 cut(s) 274
MspR9I CCNGG 1 cut(s) 94
Mva1269I GAATGC 1 cut(s) 176
MvaI CCWGG 1 cut(s) 94
NdeII GATC 3 cut(s) 97, 112, 142
NlaIII CATG 2 cut(s) 150, 211
PctI GAATGC 1 cut(s) 176
PfeI GAWTC 1 cut(s) 50
PflMI CCANNNNNTGG 1 cut(s) 37
PkrI GCNGC 1 cut(s) 16
PleI GAGTC 3 cut(s) 114, 215, 266
PpsI GAGTC 3 cut(s) 114, 215, 266
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PsuI RGATCY 1 cut(s) 112
SalI GTCGAC 1 cut(s) 260
SaqAI TTAA 1 cut(s) 274
SatI GCNGC 1 cut(s) 15
Sau3AI GATC 3 cut(s) 97, 112, 142
SchI GAGTC 3 cut(s) 114, 215, 267
ScrFI CCNGG 1 cut(s) 94
SetI ASST 6 cut(s) 23, 79, 108, 130, 155, 180
SfaNI GCATC 1 cut(s) 235
SsiI CCGC 1 cut(s) 15
SspMI CTAG 1 cut(s) 249
StyD4I CCNGG 1 cut(s) 92
StyI CCWWGG 1 cut(s) 178
TaqI TCGA 3 cut(s) 100, 118, 261
TauI GCSGC 1 cut(s) 17
TfiI GAWTC 1 cut(s) 50
Tru1I TTAA 1 cut(s) 274
Tru9I TTAA 1 cut(s) 274
TscAI CASTG 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 171
TspRI CASTG 1 cut(s) 145
Van91I CCANNNNNTGG 1 cut(s) 37
XmiI GTMKAC 1 cut(s) 261
XspI CTAG 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.