Rmu_sc0004324.1_g000007

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004324.1
OG0016469
Physical Location & Seq
Reverse (-)
36416 .. 37268
853 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004324.1_g000007.1.cds

Sequence Viewer

Length: 318 bp
atgaatcgtttgacgaaatggttgcagaaagatcaagaagaggccgtcacgagaagtagtcgacgagccttgatgatgtctgccgctgccttgcaaatccaaactctggaagataaggattcacaatggggtggttcttcagaagatcgtacctataaggcgagggatcgagagttgatggatcttcgactcaaagctcaatacttcacggatccgtgcagagaggttagatgtccagtgatgaataaaaacctccaagacgatctagtcgatcacctatggaccatgaagttacacgctgatcagaaccagcagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

105

Amino Acids

12.43

Weight (kDa)

6.72

Isoelectric Point (pI)

56.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 266
AccB7I CCANNNNNTGG 1 cut(s) 106
AccI GTMKAC 1 cut(s) 61
AciI CCGC 1 cut(s) 84
AclWI GGATC 4 cut(s) 174, 189, 206, 219
AcuI CTGAAG 1 cut(s) 123
AfaI GTAC 1 cut(s) 151
AfiI CCNNNNNNNGG 1 cut(s) 106
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
AlwI GGATC 4 cut(s) 174, 189, 206, 219
AoxI GGCC 1 cut(s) 42
ApeKI GCWGC 1 cut(s) 86
AspS9I GGNCC 1 cut(s) 282
AsuHPI GGTGA 1 cut(s) 266
AvaII GGWCC 1 cut(s) 282
BamHI GGATCC 1 cut(s) 211
BauI CACGAG 1 cut(s) 49
BbvI GCAGC 1 cut(s) 73
BccI CCATC 1 cut(s) 172
BceAI ACGGC 1 cut(s) 29
BcgI CGANNNNNNTGC 2 cut(s) 4, 38
BclI TGATCA 1 cut(s) 301
BfaI CTAG 1 cut(s) 266
BisI GCNGC 2 cut(s) 84, 87
BlsI GCNGC 2 cut(s) 85, 88
Bme18I GGWCC 1 cut(s) 282
BmgT120I GGNCC 1 cut(s) 282
BmiI GGNNCC 1 cut(s) 213
Bsc4I CCNNNNNNNGG 1 cut(s) 106
Bse1I ACTGG 1 cut(s) 236
BseLI CCNNNNNNNGG 1 cut(s) 106
BseNI ACTGG 1 cut(s) 236
BseXI GCAGC 1 cut(s) 73
BsgI GTGCAG 1 cut(s) 238
BshFI GGCC 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 106
BsnI GGCC 1 cut(s) 44
Bsp143I GATC 8 cut(s) 31, 145, 166, 181, 211, 262, 271, 301
BspACI CCGC 1 cut(s) 84
BspANI GGCC 1 cut(s) 44
BspLI GGNNCC 1 cut(s) 213
BspPI GGATC 4 cut(s) 174, 189, 206, 219
BsrI ACTGG 1 cut(s) 236
BssMI GATC 8 cut(s) 31, 145, 166, 181, 211, 262, 271, 301
BssSI CACGAG 1 cut(s) 49
Bst2BI CACGAG 1 cut(s) 49
Bst6I CTCTTC 1 cut(s) 33
BstKTI GATC 8 cut(s) 34, 148, 169, 184, 214, 265, 274, 304
BstMBI GATC 8 cut(s) 31, 145, 166, 181, 211, 262, 271, 301
BstV1I GCAGC 1 cut(s) 73
BstX2I RGATCY 2 cut(s) 181, 211
BstYI RGATCY 2 cut(s) 181, 211
BsuRI GGCC 1 cut(s) 44
BtsIMutI CAGTG 1 cut(s) 243
Cfr13I GGNCC 1 cut(s) 282
Csp6I GTAC 1 cut(s) 150
CviAII CATG 1 cut(s) 286
CviJI RGCY 3 cut(s) 44, 68, 197
CviKI_1 RGCY 3 cut(s) 44, 68, 197
CviQI GTAC 1 cut(s) 150
DpnI GATC 8 cut(s) 33, 147, 168, 183, 213, 264, 273, 303
DpnII GATC 8 cut(s) 31, 145, 166, 181, 211, 262, 271, 301
DrdI GACNNNNNNGTC 1 cut(s) 266
DseDI GACNNNNNNGTC 1 cut(s) 266
Eam1104I CTCTTC 1 cut(s) 33
EarI CTCTTC 1 cut(s) 33
Eco47I GGWCC 1 cut(s) 282
Eco57I CTGAAG 1 cut(s) 123
FaeI CATG 1 cut(s) 289
FaiI YATR 3 cut(s) 156, 280, 287
FatI CATG 1 cut(s) 285
FbaI TGATCA 1 cut(s) 301
FblI GTMKAC 1 cut(s) 61
Fnu4HI GCNGC 2 cut(s) 84, 87
Fsp4HI GCNGC 2 cut(s) 84, 87
FspBI CTAG 1 cut(s) 266
GluI GCNGC 2 cut(s) 84, 87
HaeIII GGCC 1 cut(s) 44
Hin1II CATG 1 cut(s) 289
HincII GTYRAC 1 cut(s) 62
HindII GTYRAC 1 cut(s) 62
HinfI GANTC 3 cut(s) 4, 119, 189
HphI GGTGA 1 cut(s) 266
Hpy166II GTNNAC 1 cut(s) 62
Hpy188I TCNGA 2 cut(s) 142, 306
Hpy188III TCNNGA 4 cut(s) 35, 49, 107, 170
Hpy8I GTNNAC 1 cut(s) 62
Hpy99I CGWCG 1 cut(s) 66
HpyCH4V TGCA 3 cut(s) 25, 94, 219
Hsp92II CATG 1 cut(s) 289
Ksp22I TGATCA 1 cut(s) 301
Kzo9I GATC 8 cut(s) 31, 145, 166, 181, 211, 262, 271, 301
LpnPI CCDG 2 cut(s) 92, 249
Lsp1109I GCAGC 1 cut(s) 73
MaeI CTAG 1 cut(s) 266
MaeIII GTNAC 2 cut(s) 46, 291
MalI GATC 8 cut(s) 33, 147, 168, 183, 213, 264, 273, 303
MboI GATC 8 cut(s) 31, 145, 166, 181, 211, 262, 271, 301
MboII GAAGA 5 cut(s) 50, 122, 129, 155, 176
MflI RGATCY 2 cut(s) 181, 211
MlyI GAGTC 1 cut(s) 183
MnlI CCTC 4 cut(s) 34, 156, 217, 263
MspA1I CMGCKG 1 cut(s) 86
NdeII GATC 8 cut(s) 31, 145, 166, 181, 211, 262, 271, 301
NlaIII CATG 1 cut(s) 289
NlaIV GGNNCC 1 cut(s) 213
NmuCI GTSAC 1 cut(s) 46
PcsI WCGNNNNNNNCGW 1 cut(s) 267
PfeI GAWTC 2 cut(s) 4, 119
PflMI CCANNNNNTGG 1 cut(s) 106
PkrI GCNGC 2 cut(s) 85, 88
PleI GAGTC 1 cut(s) 183
PpsI GAGTC 1 cut(s) 183
PspN4I GGNNCC 1 cut(s) 213
PspPI GGNCC 1 cut(s) 282
PsuI RGATCY 2 cut(s) 181, 211
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
SalI GTCGAC 1 cut(s) 60
SatI GCNGC 2 cut(s) 84, 87
Sau3AI GATC 8 cut(s) 31, 145, 166, 181, 211, 262, 271, 301
Sau96I GGNCC 1 cut(s) 282
SchI GAGTC 1 cut(s) 183
SetI ASST 5 cut(s) 155, 199, 228, 255, 279
SinI GGWCC 1 cut(s) 282
SsiI CCGC 1 cut(s) 84
SspMI CTAG 1 cut(s) 266
TaqI TCGA 4 cut(s) 61, 169, 187, 270
TauI GCSGC 1 cut(s) 86
TfiI GAWTC 2 cut(s) 4, 119
TscAI CASTG 1 cut(s) 243
TseFI GTSAC 1 cut(s) 46
TseI GCWGC 1 cut(s) 86
Tsp45I GTSAC 1 cut(s) 46
TspDTI ATGAA 3 cut(s) 17, 257, 302
TspGWI ACGGA 2 cut(s) 204, 224
TspRI CASTG 1 cut(s) 243
Van91I CCANNNNNTGG 1 cut(s) 106
VpaK11BI GGWCC 1 cut(s) 282
XmiI GTMKAC 1 cut(s) 61
XspI CTAG 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.