Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001421.1

Orthogroup ID

OG0010557

Physical Location & Seq

Genomic Coordinates Forward (+)

26638 .. 30203

Gene Structure 3566 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001421.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 882 bp

atgaacaagctctacagagaacttgcaaggcgctggatataccaaagggagggattcataaaggagggattcataaaaccagactacccaactcactgcagttatggaccagtaaaaactgaagaccctttcaaatggcaaggtgttattatagggcctccaggttctccttatgaagatggcgtcttcgctctttccatcgagttacctaacaattctttaactgtagcttttgttgctagagacagtagcttttgtggtcaccggagttcactggaagttggccggagacccaccggagttggccggaagtcggccggagacctgccggaagttggccggagttggccggaggtcggccggaagttggccggagcttctgctgcatctttccggcacacacataacatggcagatcgagaacttgcaaggcgctggatataccaaagggagggattcataaaggagggattcataaaaccagactacccaactcactgcagttatggaccagtaaaaactgaagaccctttcaaatggcaaggtgttattatagggcctccaggttctccttatgaagatggcgtcttcgctctttccatcgagttacctaacgactatccaaacaagcctcccatcatcaaattcctaaccaaggtttttcatccaaacattgatgaagatggcaatatttacatcgacattttagaagaagatcaatggaacccagtccagaccattgagagcctattgctctccatatgctcacttcttgatgatccaaatccagtggaccctctcaatccaagcagcgatgtcttcaaaacaaacagacaggaattcaacaaaatggcgaaagaatggactaggaaatatgcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04013 ko04120 ko04141 ko04624 map04013 map04120 map04141 map04624

Pfam Domains

Protein Families

UQ_con

Protein Analysis

293

Amino Acids

33.28

Weight (kDa)

6.12

Isoelectric Point (pI)

51.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010557)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g16400 FvH4_4g16400 FvH4_4g16400
malus_domestica	MD04G1008900.v1.1
prunus_persica	Prupe.1G008300_v2.0.a1 Prupe.1G008300_v2.0.a1 Prupe.1G008300_v2.0.a1 Prupe.1G008300_v2.0.a1 Prupe.1G008300_v2.0.a1 Prupe.1G008300_v2.0.a1 Prupe.1G008300_v2.0.a1
pyrus_communis	pycom04g00690
rosa_laevigata	RLG00000008086
rosa_multiflora	Rmu_sc0001421.1_g000010
rosa_roxburghii	Rroxscaffold_5G00359060
rosa_rugosa	Rorug04G0132500
rosa_samantha	Rh4AG193300 Rh4BG191700 Rh4CG204400 Rh4DG191200
rosa_wichuraiana	Rw4G016440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	333
AclWI	GGATC	1 cut(s)	773
AcoI	YGGCCR	7 cut(s)	283, 304, 315, 337, 347, 358, 369
AcsI	RAATTY	2 cut(s)	644, 839
AcuI	CTGAAG	2 cut(s)	141, 543
AcyI	GRCGYC	2 cut(s)	183, 585
AfiI	CCNNNNNNNGG	7 cut(s)	49, 313, 335, 356, 367, 451, 655
AgsI	TTSAA	4 cut(s)	133, 535, 823, 844
AjnI	CCWGG	2 cut(s)	160, 562
AluBI	AGCT	4 cut(s)	10, 230, 252, 377
AluI	AGCT	4 cut(s)	10, 230, 252, 377
Alw26I	GTCTC	3 cut(s)	237, 283, 315
AlwI	GGATC	1 cut(s)	773
AoxI	GGCC	9 cut(s)	155, 283, 304, 315, 337, 347, 358, 369, 557
ApeKI	GCWGC	2 cut(s)	383, 810
ApoI	RAATTY	2 cut(s)	644, 839
AspLEI	GCGC	2 cut(s)	33, 435
AspS9I	GGNCC	5 cut(s)	107, 155, 509, 557, 793
AsuHPI	GGTGA	1 cut(s)	254
AvaII	GGWCC	3 cut(s)	107, 509, 793
BbsI	GAAGAC	5 cut(s)	129, 178, 531, 580, 811
BbvI	GCAGC	2 cut(s)	370, 822
BccI	CCATC	6 cut(s)	173, 206, 575, 608, 644, 677
BciT130I	CCWGG	2 cut(s)	162, 564
BcoDI	GTCTC	3 cut(s)	237, 283, 315
BfaI	CTAG	2 cut(s)	240, 867
BfmI	CTRYAG	4 cut(s)	13, 97, 225, 499
BfoI	RGCGCY	2 cut(s)	34, 436
BfuAI	ACCTGC	1 cut(s)	333
BisI	GCNGC	2 cut(s)	384, 811
BlsI	GCNGC	2 cut(s)	385, 812
Bme1390I	CCNGG	2 cut(s)	162, 564
Bme18I	GGWCC	3 cut(s)	107, 509, 793
BmgT120I	GGNCC	5 cut(s)	107, 155, 509, 557, 793
BmiI	GGNNCC	2 cut(s)	725, 795
BmrFI	CCNGG	2 cut(s)	162, 564
BmrI	ACTGGG	1 cut(s)	722
BmsI	GCATC	1 cut(s)	395
BmuI	ACTGGG	1 cut(s)	722
BpiI	GAAGAC	5 cut(s)	129, 178, 531, 580, 811
BpmI	CTGGAG	2 cut(s)	144, 546
BsaBI	GATNNNNATC	1 cut(s)	783
BsaHI	GRCGYC	2 cut(s)	183, 585
BsaI	GGTCTC	2 cut(s)	283, 315
BsaJI	CCNNGG	1 cut(s)	654
BsaWI	WCCGGW	2 cut(s)	264, 296
Bsc4I	CCNNNNNNNGG	7 cut(s)	49, 313, 335, 356, 367, 451, 655
Bse1I	ACTGG	5 cut(s)	110, 279, 512, 728, 788
Bse8I	GATNNNNATC	1 cut(s)	783
BseBI	CCWGG	2 cut(s)	162, 564
BseDI	CCNNGG	1 cut(s)	654
BseGI	GGATG	1 cut(s)	664
BseJI	GATNNNNATC	1 cut(s)	783
BseLI	CCNNNNNNNGG	7 cut(s)	49, 313, 335, 356, 367, 451, 655
BseNI	ACTGG	5 cut(s)	110, 279, 512, 728, 788
BseX3I	CGGCCG	2 cut(s)	315, 358
BseXI	GCAGC	2 cut(s)	370, 822
Bsh1285I	CGRYCG	2 cut(s)	318, 361
BshFI	GGCC	9 cut(s)	157, 285, 306, 317, 339, 349, 360, 371, 559
BsiEI	CGRYCG	2 cut(s)	318, 361
BslI	CCNNNNNNNGG	7 cut(s)	49, 313, 335, 356, 367, 451, 655
BsmAI	GTCTC	3 cut(s)	237, 283, 315
BsnI	GGCC	9 cut(s)	157, 285, 306, 317, 339, 349, 360, 371, 559
Bso31I	GGTCTC	2 cut(s)	283, 315
Bsp143I	GATC	3 cut(s)	415, 715, 778
BspANI	GGCC	9 cut(s)	157, 285, 306, 317, 339, 349, 360, 371, 559
BspLI	GGNNCC	2 cut(s)	725, 795
BspMAI	CTGCAG	2 cut(s)	101, 503
BspMI	ACCTGC	1 cut(s)	333
BspPI	GGATC	1 cut(s)	773
BspTNI	GGTCTC	2 cut(s)	283, 315
BsrI	ACTGG	5 cut(s)	110, 279, 512, 728, 788
BssECI	CCNNGG	1 cut(s)	654
BssMI	GATC	3 cut(s)	415, 715, 778
BssNI	GRCGYC	2 cut(s)	183, 585
BssT1I	CCWWGG	1 cut(s)	654
Bst2UI	CCWGG	2 cut(s)	162, 564
Bst4CI	ACNGT	2 cut(s)	226, 248
BstACI	GRCGYC	2 cut(s)	183, 585
BstDEI	CTNAG	1 cut(s)	879
BstEII	GGTNACC	1 cut(s)	260
BstENI	CCTNNNNNAGG	1 cut(s)	653
BstF5I	GGATG	1 cut(s)	664
BstH2I	RGCGCY	2 cut(s)	34, 436
BstHHI	GCGC	2 cut(s)	33, 435
BstKTI	GATC	3 cut(s)	418, 718, 781
BstMAI	GTCTC	3 cut(s)	237, 283, 315
BstMBI	GATC	3 cut(s)	415, 715, 778
BstMCI	CGRYCG	2 cut(s)	318, 361
BstMWI	GCNNNNNNNGC	2 cut(s)	236, 383
BstNI	CCWGG	2 cut(s)	162, 564
BstPI	GGTNACC	1 cut(s)	260
BstSCI	CCNGG	2 cut(s)	160, 562
BstSFI	CTRYAG	4 cut(s)	13, 97, 225, 499
BstV1I	GCAGC	2 cut(s)	370, 822
BstV2I	GAAGAC	5 cut(s)	129, 178, 531, 580, 811
BstZI	CGGCCG	2 cut(s)	315, 358
BsuRI	GGCC	9 cut(s)	157, 285, 306, 317, 339, 349, 360, 371, 559
BtgZI	GCGATG	1 cut(s)	828
BtsCI	GGATG	1 cut(s)	664
BtsI	GCAGTG	2 cut(s)	94, 496
BtsIMutI	CAGTG	4 cut(s)	94, 272, 496, 795
BveI	ACCTGC	1 cut(s)	333
CfoI	GCGC	2 cut(s)	33, 435
Cfr13I	GGNCC	5 cut(s)	107, 155, 509, 557, 793
CseI	GACGC	2 cut(s)	172, 574
CspCI	CAANNNNNGTGG	4 cut(s)	283, 318, 771, 806
CviAII	CATG	1 cut(s)	409
DdeI	CTNAG	1 cut(s)	879
DpnI	GATC	3 cut(s)	417, 717, 780
DpnII	GATC	3 cut(s)	415, 715, 778
EaeI	YGGCCR	7 cut(s)	283, 304, 315, 337, 347, 358, 369
EagI	CGGCCG	2 cut(s)	315, 358
EclXI	CGGCCG	2 cut(s)	315, 358
Eco130I	CCWWGG	1 cut(s)	654
Eco31I	GGTCTC	2 cut(s)	283, 315
Eco47I	GGWCC	3 cut(s)	107, 509, 793
Eco52I	CGGCCG	2 cut(s)	315, 358
Eco57I	CTGAAG	2 cut(s)	141, 543
Eco91I	GGTNACC	1 cut(s)	260
EcoNI	CCTNNNNNAGG	1 cut(s)	653
EcoO109I	RGGNCCY	2 cut(s)	155, 557
EcoO65I	GGTNACC	1 cut(s)	260
EcoRI	GAATTC	1 cut(s)	839
EcoRII	CCWGG	2 cut(s)	160, 562
EcoT14I	CCWWGG	1 cut(s)	654
ErhI	CCWWGG	1 cut(s)	654
FaeI	CATG	1 cut(s)	412
FatI	CATG	1 cut(s)	408
FauNDI	CATATG	1 cut(s)	761
Fnu4HI	GCNGC	2 cut(s)	384, 811
FokI	GGATG	1 cut(s)	651
Fsp4HI	GCNGC	2 cut(s)	384, 811
FspBI	CTAG	2 cut(s)	240, 867
GlaI	GCGC	2 cut(s)	32, 434
GluI	GCNGC	2 cut(s)	384, 811
GsuI	CTGGAG	2 cut(s)	144, 546
HaeII	RGCGCY	2 cut(s)	34, 436
HaeIII	GGCC	9 cut(s)	157, 285, 306, 317, 339, 349, 360, 371, 559
HgaI	GACGC	2 cut(s)	172, 574
HhaI	GCGC	2 cut(s)	33, 435
Hin1I	GRCGYC	2 cut(s)	183, 585
Hin1II	CATG	1 cut(s)	412
Hin6I	GCGC	2 cut(s)	31, 433
HinP1I	GCGC	2 cut(s)	31, 433
HinfI	GANTC	4 cut(s)	54, 69, 456, 471
HphI	GGTGA	1 cut(s)	254
Hpy166II	GTNNAC	2 cut(s)	272, 793
Hpy188III	TCNNGA	3 cut(s)	419, 733, 773
Hpy8I	GTNNAC	2 cut(s)	272, 793
HpyCH4III	ACNGT	2 cut(s)	226, 248
HpyCH4V	TGCA	5 cut(s)	26, 99, 386, 428, 501
HpyF10VI	GCNNNNNNNGC	2 cut(s)	236, 383
HpyF3I	CTNAG	1 cut(s)	879
Hsp92I	GRCGYC	2 cut(s)	183, 585
Hsp92II	CATG	1 cut(s)	412
HspAI	GCGC	2 cut(s)	31, 433
Kzo9I	GATC	3 cut(s)	415, 715, 778
LmnI	GCTCC	1 cut(s)	374
Lsp1109I	GCAGC	2 cut(s)	370, 822
LweI	GCATC	1 cut(s)	395
MaeI	CTAG	2 cut(s)	240, 867
MaeIII	GTNAC	3 cut(s)	204, 260, 606
MalI	GATC	3 cut(s)	417, 717, 780
MboI	GATC	3 cut(s)	415, 715, 778
MluCI	AATT	3 cut(s)	214, 644, 839
MnlI	CCTC	9 cut(s)	43, 58, 168, 346, 445, 460, 570, 642, 807
MseI	TTAA	1 cut(s)	221
MspR9I	CCNGG	2 cut(s)	162, 564
MvaI	CCWGG	2 cut(s)	162, 564
MwoI	GCNNNNNNNGC	2 cut(s)	236, 383
NdeI	CATATG	1 cut(s)	761
NdeII	GATC	3 cut(s)	415, 715, 778
NlaIII	CATG	1 cut(s)	412
NlaIV	GGNNCC	2 cut(s)	725, 795
NmuCI	GTSAC	1 cut(s)	260
PfeI	GAWTC	4 cut(s)	54, 69, 456, 471
PkrI	GCNGC	2 cut(s)	385, 812
Psp6I	CCWGG	2 cut(s)	160, 562
PspEI	GGTNACC	1 cut(s)	260
PspGI	CCWGG	2 cut(s)	160, 562
PspN4I	GGNNCC	2 cut(s)	725, 795
PspPI	GGNCC	5 cut(s)	107, 155, 509, 557, 793
PsrI	GAACNNNNNNTAC	1 cut(s)	28
PstI	CTGCAG	2 cut(s)	101, 503
SaqAI	TTAA	1 cut(s)	221
SatI	GCNGC	2 cut(s)	384, 811
Sau3AI	GATC	3 cut(s)	415, 715, 778
Sau96I	GGNCC	5 cut(s)	107, 155, 509, 557, 793
ScrFI	CCNGG	2 cut(s)	162, 564
SfaNI	GCATC	1 cut(s)	395
SfcI	CTRYAG	4 cut(s)	13, 97, 225, 499
SinI	GGWCC	3 cut(s)	107, 509, 793
Sse9I	AATT	3 cut(s)	214, 644, 839
SspI	AATATT	1 cut(s)	691
SspMI	CTAG	2 cut(s)	240, 867
StyD4I	CCNGG	2 cut(s)	160, 562
StyI	CCWWGG	1 cut(s)	654
TaaI	ACNGT	2 cut(s)	226, 248
TaqI	TCGA	4 cut(s)	201, 418, 603, 699
TasI	AATT	3 cut(s)	214, 644, 839
TfiI	GAWTC	4 cut(s)	54, 69, 456, 471
Tru1I	TTAA	1 cut(s)	221
Tru9I	TTAA	1 cut(s)	221
TscAI	CASTG	4 cut(s)	101, 279, 503, 795
TseFI	GTSAC	1 cut(s)	260
TseI	GCWGC	2 cut(s)	383, 810
Tsp45I	GTSAC	1 cut(s)	260
TspDTI	ATGAA	9 cut(s)	17, 46, 61, 189, 448, 463, 591, 653, 693
TspRI	CASTG	4 cut(s)	101, 279, 503, 795
VpaK11BI	GGWCC	3 cut(s)	107, 509, 793
XagI	CCTNNNNNAGG	1 cut(s)	653
XapI	RAATTY	2 cut(s)	644, 839
XspI	CTAG	2 cut(s)	240, 867

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.