Rroxscaffold_5G00359060

Belongs to the ubiquitin-conjugating enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0010557
Physical Location & Seq
Forward (+)
39091697 .. 39097120
5424 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00359060.1

Sequence Viewer

Length: 486 bp
ATGAAAGGACATATAGCTCGGTCTGCAAACAGAGAACTTGCAAGGCACAGGATATACCAAAGGGAGGGATTCATAAAAGCAGACTTCCCAACTCACTGCAGTTATGGACCAGTAAACCTTGAAGACCCTTTCAAATGGCAAGGTGTTATTATGGGGCCTCCAGATTCTCCTTATGAAGAAGGCGTCTTCTTTCTTTCCATCGAGTTACCTGACGACTATCCAACCAAGCCTCCCATCATCAAATTCCTAACCAAGGTTTATCATCCAAACATCGATGAAGATGGCAATATTTACATTGACATTTTAGAAGAAGATCAATGGAACCCAGTCCAGACCATTGAGAGCCTATTGCTCTCCATATGCTCACTTCTTGATGATCCATATCCAGTGGACCCTCTCAATCCAAGCAGCGATGTCTTCAAAACAAACAGACAGGAATTCAACAAAATGGCGAAAGAATGGACTAGGAAATATGCTAGTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04013 ko04120 ko04141 ko04624 map04013 map04120 map04141 map04624
Pfam Domains
Protein Families
UQ_con

Protein Analysis

161

Amino Acids

18.69

Weight (kDa)

4.91

Isoelectric Point (pI)

53.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UQ_con PF00179 28 - 154 8e-43 Ubiquitin-conjugating enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 371
AcsI RAATTY 2 cut(s) 242, 437
AcyI GRCGYC 1 cut(s) 183
AfiI CCNNNNNNNGG 2 cut(s) 64, 253
AgsI TTSAA 4 cut(s) 122, 133, 421, 442
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
AlwI GGATC 1 cut(s) 371
AoxI GGCC 1 cut(s) 155
ApeKI GCWGC 1 cut(s) 408
ApoI RAATTY 2 cut(s) 242, 437
AspS9I GGNCC 3 cut(s) 107, 155, 391
AvaII GGWCC 2 cut(s) 107, 391
BbsI GAAGAC 3 cut(s) 129, 178, 409
BbvI GCAGC 1 cut(s) 420
BccI CCATC 3 cut(s) 206, 242, 275
BfaI CTAG 2 cut(s) 465, 477
BfmI CTRYAG 1 cut(s) 97
BisI GCNGC 1 cut(s) 409
BlsI GCNGC 1 cut(s) 410
Bme18I GGWCC 2 cut(s) 107, 391
BmgT120I GGNCC 3 cut(s) 107, 155, 391
BmiI GGNNCC 3 cut(s) 156, 323, 393
BmrI ACTGGG 1 cut(s) 320
BmuI ACTGGG 1 cut(s) 320
BpiI GAAGAC 3 cut(s) 129, 178, 409
BpmI CTGGAG 1 cut(s) 144
Bsa29I ATCGAT 1 cut(s) 273
BsaBI GATNNNNATC 1 cut(s) 381
BsaHI GRCGYC 1 cut(s) 183
BsaJI CCNNGG 1 cut(s) 252
BsaXI ACNNNNNCTCC 2 cut(s) 214, 244
Bsc4I CCNNNNNNNGG 2 cut(s) 64, 253
Bse1I ACTGG 3 cut(s) 110, 326, 386
Bse8I GATNNNNATC 1 cut(s) 381
BseCI ATCGAT 1 cut(s) 273
BseDI CCNNGG 1 cut(s) 252
BseGI GGATG 1 cut(s) 262
BseJI GATNNNNATC 1 cut(s) 381
BseLI CCNNNNNNNGG 2 cut(s) 64, 253
BseNI ACTGG 3 cut(s) 110, 326, 386
BseXI GCAGC 1 cut(s) 420
BshFI GGCC 1 cut(s) 157
BshVI ATCGAT 1 cut(s) 273
BslI CCNNNNNNNGG 2 cut(s) 64, 253
BsnI GGCC 1 cut(s) 157
Bsp143I GATC 2 cut(s) 313, 376
BspANI GGCC 1 cut(s) 157
BspDI ATCGAT 1 cut(s) 273
BspLI GGNNCC 3 cut(s) 156, 323, 393
BspMAI CTGCAG 1 cut(s) 101
BspPI GGATC 1 cut(s) 371
BsrI ACTGG 3 cut(s) 110, 326, 386
BssECI CCNNGG 1 cut(s) 252
BssMI GATC 2 cut(s) 313, 376
BssNI GRCGYC 1 cut(s) 183
BssT1I CCWWGG 1 cut(s) 252
BstACI GRCGYC 1 cut(s) 183
BstENI CCTNNNNNAGG 1 cut(s) 251
BstF5I GGATG 1 cut(s) 262
BstKTI GATC 2 cut(s) 316, 379
BstMBI GATC 2 cut(s) 313, 376
BstMWI GCNNNNNNNGC 1 cut(s) 23
BstSFI CTRYAG 1 cut(s) 97
BstV1I GCAGC 1 cut(s) 420
BstV2I GAAGAC 3 cut(s) 129, 178, 409
Bsu15I ATCGAT 1 cut(s) 273
BsuRI GGCC 1 cut(s) 157
BsuTUI ATCGAT 1 cut(s) 273
BtgZI GCGATG 1 cut(s) 426
BtsCI GGATG 1 cut(s) 262
BtsI GCAGTG 1 cut(s) 94
BtsIMutI CAGTG 2 cut(s) 94, 393
Cfr13I GGNCC 3 cut(s) 107, 155, 391
ClaI ATCGAT 1 cut(s) 273
CseI GACGC 1 cut(s) 172
CviJI RGCY 4 cut(s) 17, 157, 229, 345
CviKI_1 RGCY 4 cut(s) 17, 157, 229, 345
DpnI GATC 2 cut(s) 315, 378
DpnII GATC 2 cut(s) 313, 376
Eco130I CCWWGG 1 cut(s) 252
Eco47I GGWCC 2 cut(s) 107, 391
EcoNI CCTNNNNNAGG 1 cut(s) 251
EcoO109I RGGNCCY 1 cut(s) 155
EcoRI GAATTC 1 cut(s) 437
EcoT14I CCWWGG 1 cut(s) 252
ErhI CCWWGG 1 cut(s) 252
FauNDI CATATG 1 cut(s) 359
Fnu4HI GCNGC 1 cut(s) 409
FokI GGATG 1 cut(s) 249
Fsp4HI GCNGC 1 cut(s) 409
FspBI CTAG 2 cut(s) 465, 477
GluI GCNGC 1 cut(s) 409
GsuI CTGGAG 1 cut(s) 144
HaeIII GGCC 1 cut(s) 157
HgaI GACGC 1 cut(s) 172
Hin1I GRCGYC 1 cut(s) 183
HinfI GANTC 2 cut(s) 69, 164
Hpy166II GTNNAC 2 cut(s) 115, 391
Hpy188III TCNNGA 3 cut(s) 161, 331, 371
Hpy8I GTNNAC 2 cut(s) 115, 391
HpyAV CCTTC 1 cut(s) 173
HpyCH4V TGCA 3 cut(s) 26, 41, 99
HpyF10VI GCNNNNNNNGC 1 cut(s) 23
Hsp92I GRCGYC 1 cut(s) 183
Kzo9I GATC 2 cut(s) 313, 376
LpnPI CCDG 8 cut(s) 34, 123, 174, 222, 339, 344, 399, 419
Lsp1109I GCAGC 1 cut(s) 420
MaeI CTAG 2 cut(s) 465, 477
MaeIII GTNAC 1 cut(s) 204
MalI GATC 2 cut(s) 315, 378
MboI GATC 2 cut(s) 313, 376
MboII GAAGA 7 cut(s) 134, 178, 188, 290, 320, 323, 409
MluCI AATT 2 cut(s) 242, 437
MmeI TCCRAC 1 cut(s) 245
MnlI CCTC 4 cut(s) 58, 168, 240, 405
MwoI GCNNNNNNNGC 1 cut(s) 23
NdeI CATATG 1 cut(s) 359
NdeII GATC 2 cut(s) 313, 376
NlaIV GGNNCC 3 cut(s) 156, 323, 393
PfeI GAWTC 2 cut(s) 69, 164
PkrI GCNGC 1 cut(s) 410
PspN4I GGNNCC 3 cut(s) 156, 323, 393
PspPI GGNCC 3 cut(s) 107, 155, 391
PstI CTGCAG 1 cut(s) 101
SatI GCNGC 1 cut(s) 409
Sau3AI GATC 2 cut(s) 313, 376
Sau96I GGNCC 3 cut(s) 107, 155, 391
SetI ASST 5 cut(s) 19, 120, 145, 211, 258
SfcI CTRYAG 1 cut(s) 97
SinI GGWCC 2 cut(s) 107, 391
Sse9I AATT 2 cut(s) 242, 437
SspI AATATT 1 cut(s) 289
SspMI CTAG 2 cut(s) 465, 477
StyI CCWWGG 1 cut(s) 252
TaqI TCGA 2 cut(s) 201, 273
TaqII GACCGA 1 cut(s) 9
TasI AATT 2 cut(s) 242, 437
TfiI GAWTC 2 cut(s) 69, 164
TscAI CASTG 2 cut(s) 101, 393
TseI GCWGC 1 cut(s) 408
TspDTI ATGAA 4 cut(s) 17, 61, 189, 291
TspRI CASTG 2 cut(s) 101, 393
VpaK11BI GGWCC 2 cut(s) 107, 391
XagI CCTNNNNNAGG 1 cut(s) 251
XapI RAATTY 2 cut(s) 242, 437
XspI CTAG 2 cut(s) 465, 477
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.