Rw4G016440

protein modification by small protein conjugation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0010557
Physical Location & Seq
Forward (+)
37503922 .. 37505228
1307 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G016440.1

Sequence Viewer

Length: 390 bp
ATGGCAGATCGTTATGGACCAGTAAAAACTGAAGACCCTTTCAAATGGCAAGGTGTTATTATAGGGCCTCCAGGTTCTCCTTATGAAGATGGCGTCTTCGCTCTTTCCATCGAGTTACCTAACGACTATCCAAACAAGCCTCCCATCATCAAATTCCTAACCAAGGTTTTTCATCCAAACATTGATGAAGATGGCAATATTTACATCGACATTTTAGAAGAAGATCAATGGAACCCAGTCCAGACCATTGACAGCCTATTGCTCTCCATATGCTCACTTCTTGATGATCCAAATCCAGTGGACCCTCTCAATCCAAGCAGCGATGTCTTCAAAACAAACAGACAGGAATTCAACAAAATGGCGAAAGAATGGACTAGGAAATATGCTTAG

Protein Analysis

129

Amino Acids

14.74

Weight (kDa)

4.43

Isoelectric Point (pI)

51.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UQ_con PF00179 7 - 124 6.3e-43 Ubiquitin-conjugating enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 281
AcsI RAATTY 2 cut(s) 152, 347
AcuI CTGAAG 1 cut(s) 51
AcyI GRCGYC 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 163
AgsI TTSAA 3 cut(s) 43, 331, 352
AjnI CCWGG 1 cut(s) 70
AlwI GGATC 1 cut(s) 281
AoxI GGCC 1 cut(s) 65
ApeKI GCWGC 1 cut(s) 318
ApoI RAATTY 2 cut(s) 152, 347
AspS9I GGNCC 3 cut(s) 17, 65, 301
AvaII GGWCC 2 cut(s) 17, 301
BbsI GAAGAC 3 cut(s) 39, 88, 319
BbvI GCAGC 1 cut(s) 330
BccI CCATC 4 cut(s) 83, 116, 152, 185
BciT130I CCWGG 1 cut(s) 72
BfaI CTAG 1 cut(s) 375
BisI GCNGC 1 cut(s) 319
BlsI GCNGC 1 cut(s) 320
Bme1390I CCNGG 1 cut(s) 72
Bme18I GGWCC 2 cut(s) 17, 301
BmgT120I GGNCC 3 cut(s) 17, 65, 301
BmiI GGNNCC 2 cut(s) 233, 303
BmrFI CCNGG 1 cut(s) 72
BmrI ACTGGG 1 cut(s) 230
BmuI ACTGGG 1 cut(s) 230
BpiI GAAGAC 3 cut(s) 39, 88, 319
BpmI CTGGAG 1 cut(s) 54
BsaBI GATNNNNATC 1 cut(s) 291
BsaHI GRCGYC 1 cut(s) 93
BsaJI CCNNGG 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 163
Bse1I ACTGG 3 cut(s) 20, 236, 296
Bse8I GATNNNNATC 1 cut(s) 291
BseBI CCWGG 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 162
BseGI GGATG 1 cut(s) 172
BseJI GATNNNNATC 1 cut(s) 291
BseLI CCNNNNNNNGG 1 cut(s) 163
BseNI ACTGG 3 cut(s) 20, 236, 296
BseXI GCAGC 1 cut(s) 330
BshFI GGCC 1 cut(s) 67
BslI CCNNNNNNNGG 1 cut(s) 163
BsnI GGCC 1 cut(s) 67
Bsp143I GATC 3 cut(s) 7, 223, 286
BspANI GGCC 1 cut(s) 67
BspLI GGNNCC 2 cut(s) 233, 303
BspPI GGATC 1 cut(s) 281
BsrI ACTGG 3 cut(s) 20, 236, 296
BssECI CCNNGG 1 cut(s) 162
BssMI GATC 3 cut(s) 7, 223, 286
BssNI GRCGYC 1 cut(s) 93
BssT1I CCWWGG 1 cut(s) 162
Bst2UI CCWGG 1 cut(s) 72
BstACI GRCGYC 1 cut(s) 93
BstDEI CTNAG 1 cut(s) 387
BstENI CCTNNNNNAGG 1 cut(s) 161
BstF5I GGATG 1 cut(s) 172
BstKTI GATC 3 cut(s) 10, 226, 289
BstMBI GATC 3 cut(s) 7, 223, 286
BstNI CCWGG 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 70
BstV1I GCAGC 1 cut(s) 330
BstV2I GAAGAC 3 cut(s) 39, 88, 319
BsuRI GGCC 1 cut(s) 67
BtgZI GCGATG 1 cut(s) 336
BtsCI GGATG 1 cut(s) 172
BtsIMutI CAGTG 1 cut(s) 303
Cfr13I GGNCC 3 cut(s) 17, 65, 301
CseI GACGC 1 cut(s) 82
CspCI CAANNNNNGTGG 2 cut(s) 279, 314
CviJI RGCY 3 cut(s) 67, 139, 255
CviKI_1 RGCY 3 cut(s) 67, 139, 255
DdeI CTNAG 1 cut(s) 387
DpnI GATC 3 cut(s) 9, 225, 288
DpnII GATC 3 cut(s) 7, 223, 286
Eco130I CCWWGG 1 cut(s) 162
Eco47I GGWCC 2 cut(s) 17, 301
Eco57I CTGAAG 1 cut(s) 51
EcoNI CCTNNNNNAGG 1 cut(s) 161
EcoO109I RGGNCCY 1 cut(s) 65
EcoRI GAATTC 1 cut(s) 347
EcoRII CCWGG 1 cut(s) 70
EcoT14I CCWWGG 1 cut(s) 162
ErhI CCWWGG 1 cut(s) 162
FaiI YATR 6 cut(s) 15, 62, 84, 269, 271, 384
FauNDI CATATG 1 cut(s) 269
Fnu4HI GCNGC 1 cut(s) 319
FokI GGATG 1 cut(s) 159
Fsp4HI GCNGC 1 cut(s) 319
FspBI CTAG 1 cut(s) 375
GluI GCNGC 1 cut(s) 319
GsuI CTGGAG 1 cut(s) 54
HaeIII GGCC 1 cut(s) 67
HgaI GACGC 1 cut(s) 82
Hin1I GRCGYC 1 cut(s) 93
Hpy166II GTNNAC 1 cut(s) 301
Hpy188III TCNNGA 2 cut(s) 241, 281
Hpy8I GTNNAC 1 cut(s) 301
HpyF3I CTNAG 1 cut(s) 387
Hsp92I GRCGYC 1 cut(s) 93
Kzo9I GATC 3 cut(s) 7, 223, 286
LpnPI CCDG 7 cut(s) 33, 57, 84, 249, 254, 309, 329
Lsp1109I GCAGC 1 cut(s) 330
MaeI CTAG 1 cut(s) 375
MaeIII GTNAC 1 cut(s) 114
MalI GATC 3 cut(s) 9, 225, 288
MboI GATC 3 cut(s) 7, 223, 286
MboII GAAGA 7 cut(s) 44, 88, 98, 200, 230, 233, 319
MluCI AATT 2 cut(s) 152, 347
MnlI CCTC 3 cut(s) 78, 150, 315
MspR9I CCNGG 1 cut(s) 72
MvaI CCWGG 1 cut(s) 72
NdeI CATATG 1 cut(s) 269
NdeII GATC 3 cut(s) 7, 223, 286
NlaIV GGNNCC 2 cut(s) 233, 303
PkrI GCNGC 1 cut(s) 320
Psp6I CCWGG 1 cut(s) 70
PspGI CCWGG 1 cut(s) 70
PspN4I GGNNCC 2 cut(s) 233, 303
PspPI GGNCC 3 cut(s) 17, 65, 301
SatI GCNGC 1 cut(s) 319
Sau3AI GATC 3 cut(s) 7, 223, 286
Sau96I GGNCC 3 cut(s) 17, 65, 301
ScrFI CCNGG 1 cut(s) 72
SetI ASST 4 cut(s) 55, 76, 121, 168
SinI GGWCC 2 cut(s) 17, 301
Sse9I AATT 2 cut(s) 152, 347
SspI AATATT 1 cut(s) 199
SspMI CTAG 1 cut(s) 375
StyD4I CCNGG 1 cut(s) 70
StyI CCWWGG 1 cut(s) 162
TaqI TCGA 2 cut(s) 111, 207
TasI AATT 2 cut(s) 152, 347
TscAI CASTG 1 cut(s) 303
TseI GCWGC 1 cut(s) 318
TspDTI ATGAA 3 cut(s) 99, 161, 201
TspRI CASTG 1 cut(s) 303
VpaK11BI GGWCC 2 cut(s) 17, 301
XagI CCTNNNNNAGG 1 cut(s) 161
XapI RAATTY 2 cut(s) 152, 347
XspI CTAG 1 cut(s) 375
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.