Rh4CG204400

Belongs to the ubiquitin-conjugating enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0010557
Physical Location & Seq
Forward (+)
43077889 .. 43079259
1371 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG204400.1

Sequence Viewer

Length: 465 bp
ATGGCAGATCGAGAACTTGCAAGCCACTGGATATACCAAAGGGAGAGATTCATAAAAGCAGATTTCCCAACTCACTGCAGTTATGGACCAGTAAAGCTTGAAGACCCTTTCAAATGGCAAGGTGTTATTATGGGGCCTCCAGATTCTCCTTATGAAGAAGGCGTCTTCTTTCTTTCCATCGAGTTACCTGACGACTATCCAACCAAGCCTCCCATCATCAAATTCCTAACCAAGGTTTATCATCCAAACATCGATGAAGATGGCAATATTTACATTGACATTTTAGAAGAAGATCAATGGAACCCAGTCCAGACCATTGAGAGCCTATTGCTCTCCATATGCTCACTTCTTAATGATCCAAATCCAGTGGACCCTCTCAATCCAAGCACCGAAGTCTTCAAAACAAACGGACAGGAATTCAACAAATTGGCGAAAGAATGGACTAGGAAATATGCTAGTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04013 ko04120 ko04141 ko04624 map04013 map04120 map04141 map04624
Pfam Domains
Protein Families
UQ_con

Protein Analysis

154

Amino Acids

17.88

Weight (kDa)

4.59

Isoelectric Point (pI)

40.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UQ_con PF00179 20 - 147 6.5e-43 Ubiquitin-conjugating enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 350
AcsI RAATTY 2 cut(s) 221, 416
AcyI GRCGYC 1 cut(s) 162
AfiI CCNNNNNNNGG 1 cut(s) 232
AgsI TTSAA 4 cut(s) 101, 112, 400, 421
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
AlwI GGATC 1 cut(s) 350
AoxI GGCC 1 cut(s) 134
ApoI RAATTY 2 cut(s) 221, 416
AspS9I GGNCC 3 cut(s) 86, 134, 370
AvaII GGWCC 2 cut(s) 86, 370
BbsI GAAGAC 3 cut(s) 108, 157, 388
BccI CCATC 3 cut(s) 185, 221, 254
BfaI CTAG 2 cut(s) 444, 456
BfmI CTRYAG 1 cut(s) 76
Bme18I GGWCC 2 cut(s) 86, 370
BmgT120I GGNCC 3 cut(s) 86, 134, 370
BmiI GGNNCC 3 cut(s) 135, 302, 372
BmrI ACTGGG 1 cut(s) 299
BmuI ACTGGG 1 cut(s) 299
BpiI GAAGAC 3 cut(s) 108, 157, 388
BpmI CTGGAG 1 cut(s) 123
Bsa29I ATCGAT 1 cut(s) 252
BsaBI GATNNNNATC 1 cut(s) 360
BsaHI GRCGYC 1 cut(s) 162
BsaJI CCNNGG 1 cut(s) 231
BsaXI ACNNNNNCTCC 2 cut(s) 193, 223
Bsc4I CCNNNNNNNGG 1 cut(s) 232
Bse1I ACTGG 4 cut(s) 32, 89, 305, 365
Bse8I GATNNNNATC 1 cut(s) 360
BseCI ATCGAT 1 cut(s) 252
BseDI CCNNGG 1 cut(s) 231
BseGI GGATG 1 cut(s) 241
BseJI GATNNNNATC 1 cut(s) 360
BseLI CCNNNNNNNGG 1 cut(s) 232
BseNI ACTGG 4 cut(s) 32, 89, 305, 365
BshFI GGCC 1 cut(s) 136
BshVI ATCGAT 1 cut(s) 252
BslI CCNNNNNNNGG 1 cut(s) 232
BsnI GGCC 1 cut(s) 136
Bsp143I GATC 3 cut(s) 7, 292, 355
BspANI GGCC 1 cut(s) 136
BspDI ATCGAT 1 cut(s) 252
BspLI GGNNCC 3 cut(s) 135, 302, 372
BspMAI CTGCAG 1 cut(s) 80
BspPI GGATC 1 cut(s) 350
BsrI ACTGG 4 cut(s) 32, 89, 305, 365
BssECI CCNNGG 1 cut(s) 231
BssMI GATC 3 cut(s) 7, 292, 355
BssNI GRCGYC 1 cut(s) 162
BssT1I CCWWGG 1 cut(s) 231
BstACI GRCGYC 1 cut(s) 162
BstC8I GCNNGC 1 cut(s) 22
BstENI CCTNNNNNAGG 1 cut(s) 230
BstF5I GGATG 1 cut(s) 241
BstKTI GATC 3 cut(s) 10, 295, 358
BstMBI GATC 3 cut(s) 7, 292, 355
BstSFI CTRYAG 1 cut(s) 76
BstV2I GAAGAC 3 cut(s) 108, 157, 388
Bsu15I ATCGAT 1 cut(s) 252
BsuRI GGCC 1 cut(s) 136
BsuTUI ATCGAT 1 cut(s) 252
BtsCI GGATG 1 cut(s) 241
BtsI GCAGTG 1 cut(s) 73
BtsIMutI CAGTG 3 cut(s) 25, 73, 372
Cac8I GCNNGC 1 cut(s) 22
Cfr13I GGNCC 3 cut(s) 86, 134, 370
ClaI ATCGAT 1 cut(s) 252
CseI GACGC 1 cut(s) 151
CspCI CAANNNNNGTGG 2 cut(s) 348, 383
CviJI RGCY 5 cut(s) 24, 97, 136, 208, 324
CviKI_1 RGCY 5 cut(s) 24, 97, 136, 208, 324
DpnI GATC 3 cut(s) 9, 294, 357
DpnII GATC 3 cut(s) 7, 292, 355
Eco130I CCWWGG 1 cut(s) 231
Eco47I GGWCC 2 cut(s) 86, 370
EcoNI CCTNNNNNAGG 1 cut(s) 230
EcoO109I RGGNCCY 1 cut(s) 134
EcoRI GAATTC 1 cut(s) 416
EcoT14I CCWWGG 1 cut(s) 231
ErhI CCWWGG 1 cut(s) 231
FaiI YATR 8 cut(s) 34, 53, 84, 131, 153, 338, 340, 453
FauNDI CATATG 1 cut(s) 338
FokI GGATG 1 cut(s) 228
FspBI CTAG 2 cut(s) 444, 456
GsuI CTGGAG 1 cut(s) 123
HaeIII GGCC 1 cut(s) 136
HgaI GACGC 1 cut(s) 151
Hin1I GRCGYC 1 cut(s) 162
HindIII AAGCTT 1 cut(s) 95
HinfI GANTC 2 cut(s) 48, 143
Hpy166II GTNNAC 1 cut(s) 370
Hpy188III TCNNGA 3 cut(s) 11, 140, 310
Hpy8I GTNNAC 1 cut(s) 370
HpyAV CCTTC 1 cut(s) 152
HpyCH4V TGCA 2 cut(s) 20, 78
Hsp92I GRCGYC 1 cut(s) 162
Kzo9I GATC 3 cut(s) 7, 292, 355
LpnPI CCDG 8 cut(s) 13, 102, 153, 201, 318, 323, 378, 398
MaeI CTAG 2 cut(s) 444, 456
MaeIII GTNAC 1 cut(s) 183
MalI GATC 3 cut(s) 9, 294, 357
MboI GATC 3 cut(s) 7, 292, 355
MboII GAAGA 7 cut(s) 113, 157, 167, 269, 299, 302, 388
MluCI AATT 3 cut(s) 221, 416, 425
MmeI TCCRAC 1 cut(s) 224
MnlI CCTC 3 cut(s) 147, 219, 384
MseI TTAA 1 cut(s) 351
NdeI CATATG 1 cut(s) 338
NdeII GATC 3 cut(s) 7, 292, 355
NlaIV GGNNCC 3 cut(s) 135, 302, 372
PfeI GAWTC 2 cut(s) 48, 143
PspN4I GGNNCC 3 cut(s) 135, 302, 372
PspPI GGNCC 3 cut(s) 86, 134, 370
PstI CTGCAG 1 cut(s) 80
SaqAI TTAA 1 cut(s) 351
Sau3AI GATC 3 cut(s) 7, 292, 355
Sau96I GGNCC 3 cut(s) 86, 134, 370
SetI ASST 4 cut(s) 99, 124, 190, 237
SfcI CTRYAG 1 cut(s) 76
SinI GGWCC 2 cut(s) 86, 370
Sse9I AATT 3 cut(s) 221, 416, 425
SspI AATATT 1 cut(s) 268
SspMI CTAG 2 cut(s) 444, 456
StyI CCWWGG 1 cut(s) 231
TaqI TCGA 3 cut(s) 10, 180, 252
TasI AATT 3 cut(s) 221, 416, 425
TfiI GAWTC 2 cut(s) 48, 143
Tru1I TTAA 1 cut(s) 351
Tru9I TTAA 1 cut(s) 351
TscAI CASTG 3 cut(s) 32, 80, 372
TspDTI ATGAA 3 cut(s) 40, 168, 270
TspGWI ACGGA 1 cut(s) 423
TspRI CASTG 3 cut(s) 32, 80, 372
VpaK11BI GGWCC 2 cut(s) 86, 370
XagI CCTNNNNNAGG 1 cut(s) 230
XapI RAATTY 2 cut(s) 221, 416
XspI CTAG 2 cut(s) 444, 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.