Rh4AG193300

Belongs to the ubiquitin-conjugating enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0010557
Physical Location & Seq
Forward (+)
47471470 .. 47472790
1321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG193300.1

Sequence Viewer

Length: 474 bp
ATGGCAGATCGAGAACTTGCAAGGCGCTGGATATACCAAAGGGAGGGATTCATAAAGGAGGGATTCATAAAACCAGACTACCCAACTCACTGCAGTTATGGACCAGTAAAAACTGAAGACCCTTTCAAATGGCAAGGTGTTATTATAGGGCCTCCAGGTTCTCCTTATGAAGATGGCGTCTTCGCTCTTTCCATCGAGTTACCTAACGACTATCCAAACAAGCCTCCCATCATCAAATTCCTAACCAAGGTTTTTCATCCAAACATTGATGAAGATGGCAATATTTACATCGACATTTTAGAAGAAGATCAATGGAACCCAGTCCAGACCATTGAGAGCCTATTGCTCTCCATATGCTCACTTCTTGATGATCCAAATCCAGTGGACCCTCTCAATCCAAGCAGCGATGTCTTCAAAACAAACAGGCAGGAATTCAACAAAATGGCGAAAGAATGGACTAGGAAATATGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04013 ko04120 ko04141 ko04624 map04013 map04120 map04141 map04624
Pfam Domains
Protein Families
UQ_con

Protein Analysis

157

Amino Acids

18.17

Weight (kDa)

4.76

Isoelectric Point (pI)

53.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UQ_con PF00179 27 - 152 8.6e-44 Ubiquitin-conjugating enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 365
AcsI RAATTY 2 cut(s) 236, 431
AcuI CTGAAG 1 cut(s) 135
AcyI GRCGYC 1 cut(s) 177
AfiI CCNNNNNNNGG 2 cut(s) 43, 247
AgsI TTSAA 3 cut(s) 127, 415, 436
AjnI CCWGG 1 cut(s) 154
AlwI GGATC 1 cut(s) 365
AoxI GGCC 1 cut(s) 149
ApeKI GCWGC 1 cut(s) 402
ApoI RAATTY 2 cut(s) 236, 431
AspLEI GCGC 1 cut(s) 27
AspS9I GGNCC 3 cut(s) 101, 149, 385
AvaII GGWCC 2 cut(s) 101, 385
BbsI GAAGAC 3 cut(s) 123, 172, 403
BbvI GCAGC 1 cut(s) 414
BccI CCATC 4 cut(s) 167, 200, 236, 269
BciT130I CCWGG 1 cut(s) 156
BfaI CTAG 1 cut(s) 459
BfmI CTRYAG 1 cut(s) 91
BfoI RGCGCY 1 cut(s) 28
BisI GCNGC 1 cut(s) 403
BlsI GCNGC 1 cut(s) 404
Bme1390I CCNGG 1 cut(s) 156
Bme18I GGWCC 2 cut(s) 101, 385
BmgT120I GGNCC 3 cut(s) 101, 149, 385
BmiI GGNNCC 2 cut(s) 317, 387
BmrFI CCNGG 1 cut(s) 156
BmrI ACTGGG 1 cut(s) 314
BmuI ACTGGG 1 cut(s) 314
BpiI GAAGAC 3 cut(s) 123, 172, 403
BpmI CTGGAG 1 cut(s) 138
BsaBI GATNNNNATC 1 cut(s) 375
BsaHI GRCGYC 1 cut(s) 177
BsaJI CCNNGG 1 cut(s) 246
Bsc4I CCNNNNNNNGG 2 cut(s) 43, 247
Bse1I ACTGG 3 cut(s) 104, 320, 380
Bse8I GATNNNNATC 1 cut(s) 375
BseBI CCWGG 1 cut(s) 156
BseDI CCNNGG 1 cut(s) 246
BseGI GGATG 1 cut(s) 256
BseJI GATNNNNATC 1 cut(s) 375
BseLI CCNNNNNNNGG 2 cut(s) 43, 247
BseNI ACTGG 3 cut(s) 104, 320, 380
BseXI GCAGC 1 cut(s) 414
BshFI GGCC 1 cut(s) 151
BslI CCNNNNNNNGG 2 cut(s) 43, 247
BsnI GGCC 1 cut(s) 151
Bsp143I GATC 3 cut(s) 7, 307, 370
BspANI GGCC 1 cut(s) 151
BspLI GGNNCC 2 cut(s) 317, 387
BspMAI CTGCAG 1 cut(s) 95
BspPI GGATC 1 cut(s) 365
BsrI ACTGG 3 cut(s) 104, 320, 380
BssECI CCNNGG 1 cut(s) 246
BssMI GATC 3 cut(s) 7, 307, 370
BssNI GRCGYC 1 cut(s) 177
BssT1I CCWWGG 1 cut(s) 246
Bst2UI CCWGG 1 cut(s) 156
BstACI GRCGYC 1 cut(s) 177
BstDEI CTNAG 1 cut(s) 471
BstENI CCTNNNNNAGG 1 cut(s) 245
BstF5I GGATG 1 cut(s) 256
BstH2I RGCGCY 1 cut(s) 28
BstHHI GCGC 1 cut(s) 27
BstKTI GATC 3 cut(s) 10, 310, 373
BstMBI GATC 3 cut(s) 7, 307, 370
BstNI CCWGG 1 cut(s) 156
BstSCI CCNGG 1 cut(s) 154
BstSFI CTRYAG 1 cut(s) 91
BstV1I GCAGC 1 cut(s) 414
BstV2I GAAGAC 3 cut(s) 123, 172, 403
BsuRI GGCC 1 cut(s) 151
BtgZI GCGATG 1 cut(s) 420
BtsCI GGATG 1 cut(s) 256
BtsI GCAGTG 1 cut(s) 88
BtsIMutI CAGTG 2 cut(s) 88, 387
CfoI GCGC 1 cut(s) 27
Cfr13I GGNCC 3 cut(s) 101, 149, 385
CseI GACGC 1 cut(s) 166
CspCI CAANNNNNGTGG 2 cut(s) 363, 398
CviJI RGCY 3 cut(s) 151, 223, 339
CviKI_1 RGCY 3 cut(s) 151, 223, 339
DdeI CTNAG 1 cut(s) 471
DpnI GATC 3 cut(s) 9, 309, 372
DpnII GATC 3 cut(s) 7, 307, 370
Eco130I CCWWGG 1 cut(s) 246
Eco47I GGWCC 2 cut(s) 101, 385
Eco57I CTGAAG 1 cut(s) 135
EcoNI CCTNNNNNAGG 1 cut(s) 245
EcoO109I RGGNCCY 1 cut(s) 149
EcoRI GAATTC 1 cut(s) 431
EcoRII CCWGG 1 cut(s) 154
EcoT14I CCWWGG 1 cut(s) 246
ErhI CCWWGG 1 cut(s) 246
FaiI YATR 9 cut(s) 34, 53, 68, 99, 146, 168, 353, 355, 468
FauNDI CATATG 1 cut(s) 353
Fnu4HI GCNGC 1 cut(s) 403
FokI GGATG 1 cut(s) 243
Fsp4HI GCNGC 1 cut(s) 403
FspBI CTAG 1 cut(s) 459
GlaI GCGC 1 cut(s) 26
GluI GCNGC 1 cut(s) 403
GsuI CTGGAG 1 cut(s) 138
HaeII RGCGCY 1 cut(s) 28
HaeIII GGCC 1 cut(s) 151
HgaI GACGC 1 cut(s) 166
HhaI GCGC 1 cut(s) 27
Hin1I GRCGYC 1 cut(s) 177
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HinfI GANTC 2 cut(s) 48, 63
Hpy166II GTNNAC 1 cut(s) 385
Hpy188III TCNNGA 3 cut(s) 11, 325, 365
Hpy8I GTNNAC 1 cut(s) 385
HpyCH4V TGCA 2 cut(s) 20, 93
HpyF3I CTNAG 1 cut(s) 471
Hsp92I GRCGYC 1 cut(s) 177
HspAI GCGC 1 cut(s) 25
Kzo9I GATC 3 cut(s) 7, 307, 370
Lsp1109I GCAGC 1 cut(s) 414
MaeI CTAG 1 cut(s) 459
MaeIII GTNAC 1 cut(s) 198
MalI GATC 3 cut(s) 9, 309, 372
MboI GATC 3 cut(s) 7, 307, 370
MboII GAAGA 7 cut(s) 128, 172, 182, 284, 314, 317, 403
MluCI AATT 2 cut(s) 236, 431
MnlI CCTC 5 cut(s) 37, 52, 162, 234, 399
MspR9I CCNGG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 156
NdeI CATATG 1 cut(s) 353
NdeII GATC 3 cut(s) 7, 307, 370
NlaIV GGNNCC 2 cut(s) 317, 387
PfeI GAWTC 2 cut(s) 48, 63
PkrI GCNGC 1 cut(s) 404
Psp6I CCWGG 1 cut(s) 154
PspGI CCWGG 1 cut(s) 154
PspN4I GGNNCC 2 cut(s) 317, 387
PspPI GGNCC 3 cut(s) 101, 149, 385
PstI CTGCAG 1 cut(s) 95
SatI GCNGC 1 cut(s) 403
Sau3AI GATC 3 cut(s) 7, 307, 370
Sau96I GGNCC 3 cut(s) 101, 149, 385
ScrFI CCNGG 1 cut(s) 156
SetI ASST 4 cut(s) 139, 160, 205, 252
SfcI CTRYAG 1 cut(s) 91
SinI GGWCC 2 cut(s) 101, 385
Sse9I AATT 2 cut(s) 236, 431
SspI AATATT 1 cut(s) 283
SspMI CTAG 1 cut(s) 459
StyD4I CCNGG 1 cut(s) 154
StyI CCWWGG 1 cut(s) 246
TaqI TCGA 3 cut(s) 10, 195, 291
TasI AATT 2 cut(s) 236, 431
TfiI GAWTC 2 cut(s) 48, 63
TscAI CASTG 2 cut(s) 95, 387
TseI GCWGC 1 cut(s) 402
TspDTI ATGAA 5 cut(s) 40, 55, 183, 245, 285
TspRI CASTG 2 cut(s) 95, 387
VpaK11BI GGWCC 2 cut(s) 101, 385
XagI CCTNNNNNAGG 1 cut(s) 245
XapI RAATTY 2 cut(s) 236, 431
XspI CTAG 1 cut(s) 459
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.