Rmu_sc0001426.1_g000016

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001426.1
Physical Location & Seq
Forward (+)
47868 .. 49213
1346 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001426.1_g000016.1.cds

Sequence Viewer

Length: 408 bp
atgcaacctgatcaaaaacttgtaaaaaaggcagttaaatttgcattgaatgatttgaaggacaaacatgctggagttcttctaagtgctcatgccctcaaggttcgtgactgtgcccctgatcttgcaaagacaatttctagcctaatcctgtgctccaacgactcaaatttccgagaagaatgcttttcttttctcggtttaccatttcaaggagtaggaagtgaacttgttgaagactgtataaaggaaaagatcatttcagtcatagacatgaacgacagagaacaaccccagagaagcaaagaagttccaacttttctttttgaagatgatcacttccaggattcagggtctcaagatgaggaatatgaaggtgagggtgattttacctctatggatatatag

Protein Analysis

135

Amino Acids

15.17

Weight (kDa)

4.54

Isoelectric Point (pI)

35.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 38, 169
AfiI CCNNNNNNNGG 1 cut(s) 212
AgsI TTSAA 5 cut(s) 49, 58, 212, 236, 329
AjnI CCWGG 1 cut(s) 342
Alw21I GWGCWC 2 cut(s) 91, 158
Alw26I GTCTC 1 cut(s) 360
ApoI RAATTY 2 cut(s) 38, 169
AsuHPI GGTGA 2 cut(s) 389, 395
BaeGI GKGCMC 1 cut(s) 118
BbsI GAAGAC 1 cut(s) 243
Bbv12I GWGCWC 2 cut(s) 91, 158
BcgI CGANNNNNNTGC 2 cut(s) 165, 199
BciT130I CCWGG 1 cut(s) 344
BclI TGATCA 2 cut(s) 10, 334
BcoDI GTCTC 1 cut(s) 360
BfaI CTAG 1 cut(s) 141
Bme1390I CCNGG 1 cut(s) 344
BmrFI CCNGG 1 cut(s) 344
BpiI GAAGAC 1 cut(s) 243
BpmI CTGGAG 1 cut(s) 93
BpuEI CTTGAG 2 cut(s) 83, 342
BsaI GGTCTC 1 cut(s) 360
Bsc4I CCNNNNNNNGG 1 cut(s) 212
BseBI CCWGG 1 cut(s) 344
BseLI CCNNNNNNNGG 1 cut(s) 212
BseSI GKGCMC 1 cut(s) 118
BsiHKAI GWGCWC 2 cut(s) 91, 158
BslI CCNNNNNNNGG 1 cut(s) 212
BsmAI GTCTC 1 cut(s) 360
BsmI GAATGC 1 cut(s) 188
Bso31I GGTCTC 1 cut(s) 360
Bsp1286I GDGCHC 3 cut(s) 91, 118, 158
Bsp143I GATC 4 cut(s) 10, 121, 255, 334
BspTNI GGTCTC 1 cut(s) 360
BssMI GATC 4 cut(s) 10, 121, 255, 334
Bst2UI CCWGG 1 cut(s) 344
Bst4CI ACNGT 2 cut(s) 113, 242
BstDEI CTNAG 1 cut(s) 83
BstKTI GATC 4 cut(s) 13, 124, 258, 337
BstMAI GTCTC 1 cut(s) 360
BstMBI GATC 4 cut(s) 10, 121, 255, 334
BstNI CCWGG 1 cut(s) 344
BstNSI RCATGY 1 cut(s) 71
BstSCI CCNGG 1 cut(s) 342
BstSLI GKGCMC 1 cut(s) 118
BstV2I GAAGAC 1 cut(s) 243
CviAII CATG 3 cut(s) 68, 92, 274
CviJI RGCY 1 cut(s) 144
CviKI_1 RGCY 1 cut(s) 144
DdeI CTNAG 1 cut(s) 83
DpnI GATC 4 cut(s) 12, 123, 257, 336
DpnII GATC 4 cut(s) 10, 121, 255, 334
Eco31I GGTCTC 1 cut(s) 360
EcoRII CCWGG 1 cut(s) 342
FaeI CATG 3 cut(s) 71, 95, 277
FaiI YATR 9 cut(s) 69, 93, 245, 269, 275, 372, 398, 404, 406
FatI CATG 3 cut(s) 67, 91, 273
FbaI TGATCA 2 cut(s) 10, 334
FspBI CTAG 1 cut(s) 141
GsuI CTGGAG 1 cut(s) 93
Hin1II CATG 3 cut(s) 71, 95, 277
HinfI GANTC 2 cut(s) 164, 347
HphI GGTGA 2 cut(s) 389, 395
Hpy166II GTNNAC 2 cut(s) 203, 227
Hpy188I TCNGA 1 cut(s) 176
Hpy188III TCNNGA 2 cut(s) 107, 359
Hpy8I GTNNAC 2 cut(s) 203, 227
HpyAV CCTTC 2 cut(s) 52, 368
HpyCH4III ACNGT 2 cut(s) 113, 242
HpyCH4V TGCA 3 cut(s) 4, 44, 128
HpyF3I CTNAG 1 cut(s) 83
Hsp92II CATG 3 cut(s) 71, 95, 277
Ksp22I TGATCA 2 cut(s) 10, 334
Kzo9I GATC 4 cut(s) 10, 121, 255, 334
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 8 cut(s) 21, 57, 132, 164, 308, 329, 336, 356
MaeI CTAG 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 107
MalI GATC 4 cut(s) 12, 123, 257, 336
MboI GATC 4 cut(s) 10, 121, 255, 334
MboII GAAGA 4 cut(s) 71, 191, 248, 341
MhlI GDGCHC 3 cut(s) 91, 118, 158
MluCI AATT 3 cut(s) 38, 135, 169
MlyI GAGTC 1 cut(s) 158
MmeI TCCRAC 2 cut(s) 183, 338
MnlI CCTC 4 cut(s) 107, 358, 373, 403
MseI TTAA 1 cut(s) 36
MslI CAYNNNNRTG 1 cut(s) 272
MspR9I CCNGG 1 cut(s) 344
Mva1269I GAATGC 1 cut(s) 188
MvaI CCWGG 1 cut(s) 344
NdeII GATC 4 cut(s) 10, 121, 255, 334
NlaIII CATG 3 cut(s) 71, 95, 277
NmuCI GTSAC 1 cut(s) 107
NspI RCATGY 1 cut(s) 71
PctI GAATGC 1 cut(s) 188
PfeI GAWTC 1 cut(s) 347
PfoI TCCNGGA 1 cut(s) 342
PleI GAGTC 1 cut(s) 158
PpsI GAGTC 1 cut(s) 158
Psp6I CCWGG 1 cut(s) 342
PspGI CCWGG 1 cut(s) 342
RseI CAYNNNNRTG 1 cut(s) 272
SaqAI TTAA 1 cut(s) 36
Sau3AI GATC 4 cut(s) 10, 121, 255, 334
SchI GAGTC 1 cut(s) 158
ScrFI CCNGG 1 cut(s) 344
SduI GDGCHC 3 cut(s) 91, 118, 158
SetI ASST 4 cut(s) 10, 105, 379, 395
SmiMI CAYNNNNRTG 1 cut(s) 272
SmlI CTYRAG 2 cut(s) 98, 357
SmoI CTYRAG 2 cut(s) 98, 357
Sse9I AATT 3 cut(s) 38, 135, 169
SspMI CTAG 1 cut(s) 141
StyD4I CCNGG 1 cut(s) 342
TaaI ACNGT 2 cut(s) 113, 242
TasI AATT 3 cut(s) 38, 135, 169
TfiI GAWTC 1 cut(s) 347
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 290, 387
XapI RAATTY 2 cut(s) 38, 169
XceI RCATGY 1 cut(s) 71
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.