Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001677.1

Orthogroup ID

OG0009025

Physical Location & Seq

Genomic Coordinates Reverse (-)

26797 .. 32896

Gene Structure 6100 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001677.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 696 bp

atggaattgacggcatcctccgaacgtgtttgttatgttcattgcaacctctgcaacaccattttagcggtgagtgttccagcattcaacggcccattgacggcggcaacgacgacagtggtgacggtgagatgtggtcactgcgcaaatctgctgtctgttaacatcggagcagcttcgctccaataccactcaactagtcccagtcctaccactgctgctgctgctactcctcaccctcatccccatactcagcattatcattctcaccctaacattttcgcgcaccagaagcaacatcaggtgagctttgaggactcctcatcaaataaggactacggatcttcatcatcatcgtctacttcttccaaatgcaacaagtttgctgctgctcctgcatttgatcagtcctctactactgtagaccaaccaagagtctctcccattcgcccaccagagaagagacaacgcgttccttcagcttataataggtttatcaaggaggaaatccaaaggatcaaagctagtaatcctgacattagccatagggaagcttttagcacagcagccaaaaattgggcacattttcctcacattcactttgggttaaagctggaaagcaacaagcaagcaaagctggataatcaaacttttgcaggagagggaactcaaaagtctactaatggcttctactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

YABBY

Protein Analysis

231

Amino Acids

25.2

Weight (kDa)

9.05

Isoelectric Point (pI)

50.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009025)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G08465
fragaria_vesca	FvH4_3g26130 FvH4_3g26130
malus_domestica	MD00G1189200.v1.1 MD03G1159800.v1.1
prunus_persica	Prupe.6G147600_v2.0.a1 Prupe.6G147600_v2.0.a1 Prupe.6G147600_v2.0.a1 Prupe.6G147600_v2.0.a1
pyrus_communis	pycom03g11240 pycom11g14980
rosa_chinensis	RchiOBHm_Chr5g0049141
rosa_laevigata	RLG00000034593
rosa_multiflora	Rmu_sc0001677.1_g000009
rosa_roxburghii	Rroxscaffold_1G00032660
rosa_rugosa	Rorug05G0243600 Rorug05G0243700
rosa_samantha	Rh5AG322900 Rh5BG333400 Rh5CG358300 Rh5DG344800
rosa_wichuraiana	Rw5G030470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	486
Acc16I	TGCGCA	1 cut(s)	145
AccB7I	CCANNNNNTGG	1 cut(s)	576
AccI	GTMKAC	3 cut(s)	359, 423, 677
AccII	CGCG	2 cut(s)	284, 471
AciI	CCGC	2 cut(s)	68, 104
AclWI	GGATC	2 cut(s)	349, 524
AcuI	CTGAAG	1 cut(s)	462
AfiI	CCNNNNNNNGG	2 cut(s)	100, 576
AflIII	ACRYGT	2 cut(s)	25, 469
AgsI	TTSAA	1 cut(s)	88
AhlI	ACTAGT	1 cut(s)	197
AluBI	AGCT	7 cut(s)	176, 309, 482, 524, 554, 613, 637
AluI	AGCT	7 cut(s)	176, 309, 482, 524, 554, 613, 637
Alw26I	GTCTC	2 cut(s)	442, 457
AlwI	GGATC	2 cut(s)	349, 524
AoxI	GGCC	1 cut(s)	91
ApeKI	GCWGC	7 cut(s)	173, 218, 221, 224, 386, 389, 566
ArsI	GACNNNNNNTTYG	2 cut(s)	140, 172
AspLEI	GCGC	2 cut(s)	146, 286
AspS9I	GGNCC	1 cut(s)	92
AsuHPI	GGTGA	6 cut(s)	82, 133, 139, 227, 260, 316
BaeGI	GKGCMC	1 cut(s)	583
BbvI	GCAGC	7 cut(s)	185, 205, 208, 211, 373, 376, 578
BceAI	ACGGC	3 cut(s)	27, 106, 117
BclI	TGATCA	1 cut(s)	403
BcoDI	GTCTC	2 cut(s)	442, 457
BcuI	ACTAGT	1 cut(s)	197
BfaI	CTAG	2 cut(s)	198, 525
BfmI	CTRYAG	1 cut(s)	420
BisI	GCNGC	8 cut(s)	105, 174, 219, 222, 225, 387, 390, 567
BlsI	GCNGC	8 cut(s)	106, 175, 220, 223, 226, 388, 391, 568
BmgT120I	GGNCC	1 cut(s)	92
BmrI	ACTGGG	1 cut(s)	198
BmsI	GCATC	1 cut(s)	23
BmuI	ACTGGG	1 cut(s)	198
BplI	GAGNNNNNCTC	2 cut(s)	305, 337
BsaBI	GATNNNNATC	1 cut(s)	346
Bsc4I	CCNNNNNNNGG	2 cut(s)	100, 576
Bse1I	ACTGG	1 cut(s)	204
Bse3DI	GCAATG	1 cut(s)	40
Bse8I	GATNNNNATC	1 cut(s)	346
BseGI	GGATG	2 cut(s)	14, 241
BseJI	GATNNNNATC	1 cut(s)	346
BseLI	CCNNNNNNNGG	2 cut(s)	100, 576
BseMI	GCAATG	1 cut(s)	40
BseMII	CTCAG	1 cut(s)	266
BseNI	ACTGG	1 cut(s)	204
BseRI	GAGGAG	2 cut(s)	222, 310
BseSI	GKGCMC	1 cut(s)	583
BseXI	GCAGC	7 cut(s)	185, 205, 208, 211, 373, 376, 578
Bsh1236I	CGCG	2 cut(s)	284, 471
BshFI	GGCC	1 cut(s)	93
BslFI	GGGAC	1 cut(s)	186
BslI	CCNNNNNNNGG	2 cut(s)	100, 576
BsmAI	GTCTC	2 cut(s)	442, 457
BsmFI	GGGAC	1 cut(s)	186
BsmI	GAATGC	1 cut(s)	83
BsnI	GGCC	1 cut(s)	93
Bsp1286I	GDGCHC	1 cut(s)	583
Bsp143I	GATC	3 cut(s)	341, 403, 516
BspACI	CCGC	2 cut(s)	68, 104
BspANI	GGCC	1 cut(s)	93
BspCNI	CTCAG	1 cut(s)	265
BspFNI	CGCG	2 cut(s)	284, 471
BspPI	GGATC	2 cut(s)	349, 524
BsrDI	GCAATG	1 cut(s)	40
BsrI	ACTGG	1 cut(s)	204
BssMI	GATC	3 cut(s)	341, 403, 516
Bst4CI	ACNGT	3 cut(s)	118, 127, 421
Bst6I	CTCTTC	1 cut(s)	455
BstAPI	GCANNNNNTGC	1 cut(s)	51
BstC8I	GCNNGC	1 cut(s)	630
BstDEI	CTNAG	1 cut(s)	252
BstF5I	GGATG	2 cut(s)	14, 241
BstFNI	CGCG	2 cut(s)	284, 471
BstHHI	GCGC	2 cut(s)	146, 286
BstKTI	GATC	3 cut(s)	344, 406, 519
BstMAI	GTCTC	2 cut(s)	442, 457
BstMBI	GATC	3 cut(s)	341, 403, 516
BstMWI	GCNNNNNNNGC	5 cut(s)	51, 224, 292, 395, 634
BstSFI	CTRYAG	1 cut(s)	420
BstSLI	GKGCMC	1 cut(s)	583
BstUI	CGCG	2 cut(s)	284, 471
BstV1I	GCAGC	7 cut(s)	185, 205, 208, 211, 373, 376, 578
BstX2I	RGATCY	1 cut(s)	341
BstYI	RGATCY	1 cut(s)	341
BsuRI	GGCC	1 cut(s)	93
BtsCI	GGATG	2 cut(s)	14, 241
BtsI	GCAGTG	2 cut(s)	139, 213
BtsIMutI	CAGTG	3 cut(s)	123, 139, 213
Cac8I	GCNNGC	1 cut(s)	630
CfoI	GCGC	2 cut(s)	146, 286
Cfr13I	GGNCC	1 cut(s)	92
DdeI	CTNAG	1 cut(s)	252
DpnI	GATC	3 cut(s)	343, 405, 518
DpnII	GATC	3 cut(s)	341, 403, 516
Eam1104I	CTCTTC	1 cut(s)	455
EarI	CTCTTC	1 cut(s)	455
Eco57I	CTGAAG	1 cut(s)	462
FaiI	YATR	4 cut(s)	36, 249, 486, 546
FaqI	GGGAC	1 cut(s)	186
FbaI	TGATCA	1 cut(s)	403
FblI	GTMKAC	3 cut(s)	359, 423, 677
Fnu4HI	GCNGC	8 cut(s)	105, 174, 219, 222, 225, 387, 390, 567
FokI	GGATG	1 cut(s)	228
Fsp4HI	GCNGC	8 cut(s)	105, 174, 219, 222, 225, 387, 390, 567
FspBI	CTAG	2 cut(s)	198, 525
FspI	TGCGCA	1 cut(s)	145
GlaI	GCGC	2 cut(s)	145, 285
GluI	GCNGC	8 cut(s)	105, 174, 219, 222, 225, 387, 390, 567
HaeIII	GGCC	1 cut(s)	93
HhaI	GCGC	2 cut(s)	146, 286
Hin6I	GCGC	2 cut(s)	144, 284
HinP1I	GCGC	2 cut(s)	144, 284
HincII	GTYRAC	1 cut(s)	163
HindII	GTYRAC	1 cut(s)	163
HindIII	AAGCTT	1 cut(s)	552
HinfI	GANTC	2 cut(s)	317, 435
HpaI	GTTAAC	1 cut(s)	163
HphI	GGTGA	6 cut(s)	82, 133, 139, 227, 260, 316
Hpy166II	GTNNAC	4 cut(s)	163, 360, 424, 678
Hpy188I	TCNGA	2 cut(s)	22, 170
Hpy188III	TCNNGA	1 cut(s)	533
Hpy8I	GTNNAC	4 cut(s)	163, 360, 424, 678
Hpy99I	CGWCG	1 cut(s)	115
HpyAV	CCTTC	1 cut(s)	486
HpyCH4III	ACNGT	3 cut(s)	118, 127, 421
HpyCH4IV	ACGT	1 cut(s)	25
HpyCH4V	TGCA	5 cut(s)	45, 54, 375, 398, 656
HpyF10VI	GCNNNNNNNGC	5 cut(s)	51, 224, 292, 395, 634
HpyF3I	CTNAG	1 cut(s)	252
HpySE526I	ACGT	1 cut(s)	25
HspAI	GCGC	2 cut(s)	144, 284
Ksp22I	TGATCA	1 cut(s)	403
KspAI	GTTAAC	1 cut(s)	163
Kzo9I	GATC	3 cut(s)	341, 403, 516
LmnI	GCTCC	3 cut(s)	170, 186, 397
Lsp1109I	GCAGC	7 cut(s)	185, 205, 208, 211, 373, 376, 578
LweI	GCATC	1 cut(s)	23
MaeI	CTAG	2 cut(s)	198, 525
MaeII	ACGT	1 cut(s)	25
MaeIII	GTNAC	2 cut(s)	121, 137
MalI	GATC	3 cut(s)	343, 405, 518
MboI	GATC	3 cut(s)	341, 403, 516
MboII	GAAGA	3 cut(s)	336, 357, 472
MflI	RGATCY	1 cut(s)	341
MhlI	GDGCHC	1 cut(s)	583
MluCI	AATT	2 cut(s)	5, 574
MluI	ACGCGT	1 cut(s)	469
MlyI	GAGTC	2 cut(s)	311, 444
MseI	TTAA	2 cut(s)	162, 608
Mva1269I	GAATGC	1 cut(s)	83
MvnI	CGCG	2 cut(s)	284, 471
MwoI	GCNNNNNNNGC	5 cut(s)	51, 224, 292, 395, 634
NdeII	GATC	3 cut(s)	341, 403, 516
NmuCI	GTSAC	2 cut(s)	121, 137
NsbI	TGCGCA	1 cut(s)	145
PcsI	WCGNNNNNNNCGW	1 cut(s)	107
PctI	GAATGC	1 cut(s)	83
PflMI	CCANNNNNTGG	1 cut(s)	576
PkrI	GCNGC	8 cut(s)	106, 175, 220, 223, 226, 388, 391, 568
PleI	GAGTC	2 cut(s)	311, 443
PpsI	GAGTC	2 cut(s)	311, 443
PsiI	TTATAA	1 cut(s)	486
PspPI	GGNCC	1 cut(s)	92
PsuI	RGATCY	1 cut(s)	341
SaqAI	TTAA	2 cut(s)	162, 608
SatI	GCNGC	8 cut(s)	105, 174, 219, 222, 225, 387, 390, 567
Sau3AI	GATC	3 cut(s)	341, 403, 516
Sau96I	GGNCC	1 cut(s)	92
SchI	GAGTC	2 cut(s)	311, 444
SduI	GDGCHC	1 cut(s)	583
SfaNI	GCATC	1 cut(s)	23
SfcI	CTRYAG	1 cut(s)	420
SpeI	ACTAGT	1 cut(s)	197
Sse9I	AATT	2 cut(s)	5, 574
SsiI	CCGC	2 cut(s)	68, 104
SspMI	CTAG	2 cut(s)	198, 525
TaaI	ACNGT	3 cut(s)	118, 127, 421
TaiI	ACGT	1 cut(s)	28
TasI	AATT	2 cut(s)	5, 574
TauI	GCSGC	1 cut(s)	107
Tru1I	TTAA	2 cut(s)	162, 608
Tru9I	TTAA	2 cut(s)	162, 608
TscAI	CASTG	3 cut(s)	123, 146, 220
TseFI	GTSAC	2 cut(s)	121, 137
TseI	GCWGC	7 cut(s)	173, 218, 221, 224, 386, 389, 566
Tsp45I	GTSAC	2 cut(s)	121, 137
TspDTI	ATGAA	2 cut(s)	29, 336
TspGWI	ACGGA	1 cut(s)	354
TspRI	CASTG	3 cut(s)	123, 146, 220
Van91I	CCANNNNNTGG	1 cut(s)	576
XmiI	GTMKAC	3 cut(s)	359, 423, 677
XspI	CTAG	2 cut(s)	198, 525

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.