Rmu_sc0001753.1_g000030

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001753.1
Physical Location & Seq
Reverse (-)
148457 .. 151650
3194 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001753.1_g000030.1.cds

Sequence Viewer

Length: 1215 bp
atggcttttctgttcaacaagtttcaggaggctgtcaaagttcttgcgaaaaattcccctatgcttgccaagaatcctaggaaactacaatttgaggcagatattaaccgccttttcctatataccagctacaatcgcttgggaaaggacgctgatgaggcagatgtggacgagattattgacatggctaataaagcctctgttgatgatcaacagaaacaagtccaagaaaacattcatcttcaaattaaaagcttctgcatgtctatggatgaacttcttctacctgatgtaaagagcacaaatgaggtcactgaatcacctaaacaatcaaatgctactcctcaacgaagtggacttagtttagctattggcaggaacagaccaggagataaacatcctgatgtgcctgagacaaggccattagaacacgctgatgtatctcaaaaattgaaagatctcattggctacactctcgatatcaaaccttctcagataccccataaggaagcaggccaaggcttatttttaaatggtgaatgtgatgttggtgctgtggtggctgtgtaccctggtgtaatatactccccagcatattaccgttacattcctggatatccaagagttgatgcacagaactcatatctgatcacaaggtatgatggaactgtgatcaatgccaaaccttggggttctgggggtgaaacacgtgatttctgggatgggttaacagtaccagagatcagacctaatatgcaaggagatgggaaaggttcagatcggctcttgaagctcctaagtaagcccttggatggcaggcgactgggaaagagtggcgacattatagagcggaggaaccctttagctttggctcattttgccaaccaccctgcaaagggtgtggagccgaatgtaatgatttgcccttatgacttcccattaaccgaaaaggaaatgagagtttatattccgaatgtagtttttggaaatgcagaagaagtgaagatgaagaaatttgggagcttttggttgaaacttgggagttcaagaaatagcggatcagatgttcctgttttgaagacccttgttatggtagctacaagggcactttgtgatgaagaagtgcttttgaactacaggttgagcaactctaagcgtcggccagagtggtatagtccagtcaatgaggaggaagaccgaagaaggtggagctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

404

Amino Acids

45.55

Weight (kDa)

7.63

Isoelectric Point (pI)

45.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 687
AccBSI CCGCTC 1 cut(s) 850
AciI CCGC 3 cut(s) 109, 850, 1056
AclWI GGATC 1 cut(s) 1066
AcoI YGGCCR 1 cut(s) 1160
AcsI RAATTY 2 cut(s) 52, 1013
AcvI CACGTG 1 cut(s) 710
AdeI CACNNNGTG 1 cut(s) 1112
AfaI GTAC 2 cut(s) 569, 735
AfiI CCNNNNNNNGG 5 cut(s) 687, 812, 895, 896, 1090
AflIII ACRYGT 1 cut(s) 707
AgsI TTSAA 8 cut(s) 16, 245, 454, 790, 1033, 1047, 1078, 1132
AjnI CCWGG 3 cut(s) 385, 571, 610
AjuI GAANNNNNNNTTGG 4 cut(s) 219, 251, 531, 563
AloI GAACNNNNNNTCC 2 cut(s) 1050, 1082
AluBI AGCT 8 cut(s) 129, 255, 368, 793, 866, 1023, 1097, 1212
AluI AGCT 8 cut(s) 129, 255, 368, 793, 866, 1023, 1097, 1212
Alw21I GWGCWC 1 cut(s) 302
Alw26I GTCTC 1 cut(s) 407
AlwI GGATC 1 cut(s) 1066
AoxI GGCC 3 cut(s) 419, 514, 1160
ApoI RAATTY 2 cut(s) 52, 1013
Asp700I GAANNNNTTC 2 cut(s) 234, 279
AspA2I CCTAGG 1 cut(s) 77
AsuHPI GGTGA 3 cut(s) 312, 548, 713
AvrII CCTAGG 1 cut(s) 77
BaeGI GKGCMC 1 cut(s) 1108
BbrPI CACGTG 1 cut(s) 710
BbsI GAAGAC 2 cut(s) 1085, 1200
Bbv12I GWGCWC 1 cut(s) 302
BccI CCATC 4 cut(s) 656, 716, 758, 806
BciT130I CCWGG 3 cut(s) 387, 573, 612
BclI TGATCA 3 cut(s) 208, 648, 672
BcoDI GTCTC 1 cut(s) 407
BfaI CTAG 1 cut(s) 78
BfmI CTRYAG 1 cut(s) 1135
BglII AGATCT 1 cut(s) 457
BlnI CCTAGG 1 cut(s) 77
Bme1390I CCNGG 3 cut(s) 387, 573, 612
BmiI GGNNCC 2 cut(s) 857, 906
BmrFI CCNGG 3 cut(s) 387, 573, 612
BmrI ACTGGG 1 cut(s) 833
BmsI GCATC 1 cut(s) 619
BmuI ACTGGG 1 cut(s) 833
BpiI GAAGAC 2 cut(s) 1085, 1200
BsaAI YACGTR 1 cut(s) 710
BsaBI GATNNNNATC 1 cut(s) 396
BsaJI CCNNGG 5 cut(s) 77, 517, 571, 686, 807
Bsc4I CCNNNNNNNGG 5 cut(s) 687, 812, 895, 896, 1090
Bse1I ACTGG 2 cut(s) 828, 1178
Bse8I GATNNNNATC 1 cut(s) 396
BseBI CCWGG 3 cut(s) 387, 573, 612
BseDI CCNNGG 5 cut(s) 77, 517, 571, 686, 807
BseGI GGATG 4 cut(s) 277, 397, 727, 817
BseJI GATNNNNATC 1 cut(s) 396
BseLI CCNNNNNNNGG 5 cut(s) 687, 812, 895, 896, 1090
BseMII CTCAG 2 cut(s) 402, 506
BseNI ACTGG 2 cut(s) 828, 1178
BseRI GAGGAG 2 cut(s) 333, 1202
BseSI GKGCMC 1 cut(s) 1108
BseYI CCCAGC 1 cut(s) 589
BshFI GGCC 3 cut(s) 421, 516, 1162
BsiHKAI GWGCWC 1 cut(s) 302
BslI CCNNNNNNNGG 5 cut(s) 687, 812, 895, 896, 1090
BsmAI GTCTC 1 cut(s) 407
BsnI GGCC 3 cut(s) 421, 516, 1162
Bsp1286I GDGCHC 2 cut(s) 302, 1108
Bsp143I GATC 7 cut(s) 208, 457, 648, 672, 741, 778, 1058
BspACI CCGC 3 cut(s) 109, 850, 1056
BspANI GGCC 3 cut(s) 421, 516, 1162
BspCNI CTCAG 2 cut(s) 403, 505
BspLI GGNNCC 2 cut(s) 857, 906
BspPI GGATC 1 cut(s) 1066
BsrBI CCGCTC 1 cut(s) 850
BsrI ACTGG 2 cut(s) 828, 1178
BssECI CCNNGG 5 cut(s) 77, 517, 571, 686, 807
BssMI GATC 7 cut(s) 208, 457, 648, 672, 741, 778, 1058
BssT1I CCWWGG 4 cut(s) 77, 517, 686, 807
Bst2UI CCWGG 3 cut(s) 387, 573, 612
Bst4CI ACNGT 3 cut(s) 602, 670, 733
BstBAI YACGTR 1 cut(s) 710
BstC8I GCNNGC 3 cut(s) 66, 514, 818
BstDEI CTNAG 5 cut(s) 359, 411, 492, 797, 1152
BstF5I GGATG 4 cut(s) 277, 397, 727, 817
BstKTI GATC 7 cut(s) 211, 460, 651, 675, 744, 781, 1061
BstMAI GTCTC 1 cut(s) 407
BstMBI GATC 7 cut(s) 208, 457, 648, 672, 741, 778, 1058
BstMWI GCNNNNNNNGC 7 cut(s) 135, 158, 194, 560, 790, 878, 1103
BstNI CCWGG 3 cut(s) 387, 573, 612
BstNSI RCATGY 1 cut(s) 265
BstSCI CCNGG 3 cut(s) 385, 571, 610
BstSFI CTRYAG 1 cut(s) 1135
BstSLI GKGCMC 1 cut(s) 1108
BstV2I GAAGAC 2 cut(s) 1085, 1200
BstX2I RGATCY 1 cut(s) 457
BstYI RGATCY 1 cut(s) 457
BsuRI GGCC 3 cut(s) 421, 516, 1162
BtsCI GGATG 4 cut(s) 277, 397, 727, 817
BtsIMutI CAGTG 1 cut(s) 312
Cac8I GCNNGC 3 cut(s) 66, 514, 818
CseI GACGC 2 cut(s) 158, 1145
Csp6I GTAC 2 cut(s) 568, 734
CspCI CAANNNNNGTGG 2 cut(s) 882, 917
CviAII CATG 2 cut(s) 184, 262
CviQI GTAC 2 cut(s) 568, 734
DdeI CTNAG 5 cut(s) 359, 411, 492, 797, 1152
DpnI GATC 7 cut(s) 210, 459, 650, 674, 743, 780, 1060
DpnII GATC 7 cut(s) 208, 457, 648, 672, 741, 778, 1058
DraI TTTAAA 1 cut(s) 531
DraIII CACNNNGTG 1 cut(s) 1112
EaeI YGGCCR 1 cut(s) 1160
Eco130I CCWWGG 4 cut(s) 77, 517, 686, 807
Eco32I GATATC 2 cut(s) 481, 617
Eco72I CACGTG 1 cut(s) 710
EcoRII CCWGG 3 cut(s) 385, 571, 610
EcoRV GATATC 2 cut(s) 481, 617
EcoT14I CCWWGG 4 cut(s) 77, 517, 686, 807
ErhI CCWWGG 4 cut(s) 77, 517, 686, 807
FaeI CATG 2 cut(s) 187, 265
FalI AAGNNNNNCTT 2 cut(s) 1110, 1142
FatI CATG 2 cut(s) 183, 261
FbaI TGATCA 3 cut(s) 208, 648, 672
FokI GGATG 4 cut(s) 284, 384, 734, 824
FspBI CTAG 1 cut(s) 78
GsaI CCCAGC 1 cut(s) 593
HaeIII GGCC 3 cut(s) 421, 516, 1162
HgaI GACGC 2 cut(s) 158, 1145
Hin1II CATG 2 cut(s) 187, 265
HincII GTYRAC 1 cut(s) 729
HindII GTYRAC 1 cut(s) 729
HindIII AAGCTT 1 cut(s) 253
HinfI GANTC 2 cut(s) 73, 317
HpaI GTTAAC 1 cut(s) 729
HphI GGTGA 3 cut(s) 312, 548, 713
Hpy166II GTNNAC 4 cut(s) 169, 356, 568, 729
Hpy188I TCNGA 6 cut(s) 495, 648, 746, 778, 972, 1063
Hpy188III TCNNGA 5 cut(s) 26, 401, 476, 787, 1047
Hpy8I GTNNAC 4 cut(s) 169, 356, 568, 729
Hpy99I CGWCG 1 cut(s) 1161
HpyAV CCTTC 2 cut(s) 498, 1197
HpyCH4III ACNGT 3 cut(s) 602, 670, 733
HpyCH4IV ACGT 1 cut(s) 709
HpyCH4V TGCA 5 cut(s) 261, 632, 757, 893, 992
HpyF10VI GCNNNNNNNGC 7 cut(s) 135, 158, 194, 560, 790, 878, 1103
HpyF3I CTNAG 5 cut(s) 359, 411, 492, 797, 1152
HpySE526I ACGT 1 cut(s) 709
Hsp92II CATG 2 cut(s) 187, 265
Ksp22I TGATCA 3 cut(s) 208, 648, 672
KspAI GTTAAC 1 cut(s) 729
Kzo9I GATC 7 cut(s) 208, 457, 648, 672, 741, 778, 1058
LmnI GCTCC 4 cut(s) 798, 904, 1020, 1209
LweI GCATC 1 cut(s) 619
MaeI CTAG 1 cut(s) 78
MaeII ACGT 1 cut(s) 709
MaeIII GTNAC 2 cut(s) 310, 602
MalI GATC 7 cut(s) 210, 459, 650, 674, 743, 780, 1060
MbiI CCGCTC 1 cut(s) 850
MboI GATC 7 cut(s) 208, 457, 648, 672, 741, 778, 1058
MboII GAAGA 9 cut(s) 233, 272, 1007, 1015, 1021, 1090, 1130, 1205, 1212
MflI RGATCY 1 cut(s) 457
MhlI GDGCHC 2 cut(s) 302, 1108
MluCI AATT 5 cut(s) 52, 89, 246, 449, 1013
MnlI CCTC 9 cut(s) 22, 88, 151, 208, 301, 354, 846, 1180, 1183
MroXI GAANNNNTTC 2 cut(s) 234, 279
MseI TTAA 5 cut(s) 105, 249, 530, 728, 941
MslI CAYNNNNRTG 3 cut(s) 266, 402, 435
MspR9I CCNGG 3 cut(s) 387, 573, 612
MvaI CCWGG 3 cut(s) 387, 573, 612
MwoI GCNNNNNNNGC 7 cut(s) 135, 158, 194, 560, 790, 878, 1103
NdeII GATC 7 cut(s) 208, 457, 648, 672, 741, 778, 1058
NlaIII CATG 2 cut(s) 187, 265
NlaIV GGNNCC 2 cut(s) 857, 906
NmuCI GTSAC 1 cut(s) 310
NspI RCATGY 1 cut(s) 265
PdmI GAANNNNTTC 2 cut(s) 234, 279
PfeI GAWTC 2 cut(s) 73, 317
PflMI CCANNNNNTGG 1 cut(s) 687
PfoI TCCNGGA 1 cut(s) 610
PmaCI CACGTG 1 cut(s) 710
PmlI CACGTG 1 cut(s) 710
Ppu21I YACGTR 1 cut(s) 710
Psp6I CCWGG 3 cut(s) 385, 571, 610
PspCI CACGTG 1 cut(s) 710
PspFI CCCAGC 1 cut(s) 589
PspGI CCWGG 3 cut(s) 385, 571, 610
PspN4I GGNNCC 2 cut(s) 857, 906
PsrI GAACNNNNNNTAC 2 cut(s) 267, 299
PsuI RGATCY 1 cut(s) 457
RsaI GTAC 2 cut(s) 569, 735
RsaNI GTAC 2 cut(s) 568, 734
RseI CAYNNNNRTG 3 cut(s) 266, 402, 435
SaqAI TTAA 5 cut(s) 105, 249, 530, 728, 941
Sau3AI GATC 7 cut(s) 208, 457, 648, 672, 741, 778, 1058
ScrFI CCNGG 3 cut(s) 387, 573, 612
SduI GDGCHC 2 cut(s) 302, 1108
SfaNI GCATC 1 cut(s) 619
SfcI CTRYAG 1 cut(s) 1135
SmiMI CAYNNNNRTG 3 cut(s) 266, 402, 435
Sse9I AATT 5 cut(s) 52, 89, 246, 449, 1013
SsiI CCGC 3 cut(s) 109, 850, 1056
SspMI CTAG 1 cut(s) 78
StyD4I CCNGG 3 cut(s) 385, 571, 610
StyI CCWWGG 4 cut(s) 77, 517, 686, 807
TaaI ACNGT 3 cut(s) 602, 670, 733
TaiI ACGT 1 cut(s) 712
TaqI TCGA 1 cut(s) 477
TaqII GACCGA 1 cut(s) 1212
TasI AATT 5 cut(s) 52, 89, 246, 449, 1013
TfiI GAWTC 2 cut(s) 73, 317
Tru1I TTAA 5 cut(s) 105, 249, 530, 728, 941
Tru9I TTAA 5 cut(s) 105, 249, 530, 728, 941
TscAI CASTG 1 cut(s) 319
TseFI GTSAC 1 cut(s) 310
Tsp45I GTSAC 1 cut(s) 310
TspDTI ATGAA 4 cut(s) 227, 288, 1022, 1131
TspRI CASTG 1 cut(s) 319
Van91I CCANNNNNTGG 1 cut(s) 687
XapI RAATTY 2 cut(s) 52, 1013
XceI RCATGY 1 cut(s) 265
XmaJI CCTAGG 1 cut(s) 77
XmnI GAANNNNTTC 2 cut(s) 234, 279
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.