Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001807.1

Orthogroup ID

OG0004363

Physical Location & Seq

Genomic Coordinates Forward (+)

2136 .. 5792

Gene Structure 3657 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001807.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1077 bp

atggactggcttgagctcgagcccgtttgctacctctacctctacctctacctctacctctaccctatccgagcagaacagtatcaactaggaaccgagaatttgccttgtccgctgggtcattgggctgcggccgatgagcctccttgtgagcaaggtcattcgtatgaactgtctaaagactcaacctttaccgctctacgacgactcctcccgaggtcgaaccaaatggaatgtagtgaagagagtagatgcagagagctggccaaagcctctaccttttaccgtgccgtctactctgagatagaggaagttgggtgggagaatctcgtgagatttggtggagatctaacatctctcagctttcgggtcttagatagtaagggcagagtgcatgttatggaaattcaattggataaaacccatcctacctatcctccttcaatttcggcagatgtaccttatttgtttaatttaaaatggtcatcgaactcaagattgaaagatgtggttcagcagtttagaaagcatctggagaagcttcagacattttggtctactttggatgatattgataggtccctatgtgttgaacctaaacaagcatctcctgctgtatccaatcgccaagtcattataggaaatgattgtttcgtcatgttgtctattcatgccactgatcctagatctttaccagagtgtcgttttattggtacaggtcaaatcgtgaaccttttgagagacagatggcagagaaatagcaaaagatgggtaaaagacaacaaatttctggttaatctcgaaactcttctggagactcagcttccaaagcctgcagatgttgagaagaatgatcagcaagtggaatgcggaatttgttatgctccgagtcttccagttgatgatgagctcagaggtaagagtggaactgggactgactatacatgcgataataccagctgcaagagggcttttcatagcatatgtctcgtggactggctgcgttccattaccacaacaaggcagtatgttaaggctcttgtatcactgtcatctttccactggttattgcactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03460 ko04120 map03460 map04120

Pfam Domains

Protein Families

FANCL_C WD-3

Protein Analysis

358

Amino Acids

41.33

Weight (kDa)

6.03

Isoelectric Point (pI)

50.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004363)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G65740 AT5G65740 AT5G65740 AT5G65740 AT5G65740 AT5G65740 AT5G65740 AT5G65740 AT5G65740
fragaria_vesca	FvH4_1g18540 FvH4_1g18540 FvH4_1g18540
malus_domestica	MD02G1192700.v1.1 MD15G1303200.v1.1
prunus_persica	Prupe.6G213700_v2.0.a1 Prupe.6G213700_v2.0.a1 Prupe.6G213700_v2.0.a1 Prupe.6G213700_v2.0.a1 Prupe.6G213700_v2.0.a1
pyrus_communis	pycom02g15670
rosa_chinensis	RchiOBHm_Chr2g0109231
rosa_laevigata	RLG00000017727
rosa_multiflora	Rmu_sc0001807.1_g000002
rosa_roxburghii	Rroxscaffold_2G00134380
rosa_rugosa	Rorug02G0158700.1 Rorug07G0270600
rosa_samantha	Rh2AG210100 Rh2AG412800 Rh2BG220500 Rh2CG212500 Rh2DG216300 Rh7BG235400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	553
AccBSI	CCGCTC	1 cut(s)	197
AccI	GTMKAC	2 cut(s)	294, 557
AciI	CCGC	4 cut(s)	113, 131, 195, 870
AclWI	GGATC	1 cut(s)	674
AcoI	YGGCCR	2 cut(s)	132, 264
AcsI	RAATTY	4 cut(s)	100, 405, 785, 873
AcuI	CTGAAG	1 cut(s)	527
AfaI	GTAC	2 cut(s)	459, 715
AfiI	CCNNNNNNNGG	1 cut(s)	1020
AgsI	TTSAA	4 cut(s)	410, 444, 502, 593
AluBI	AGCT	7 cut(s)	16, 262, 363, 541, 823, 910, 960
AluI	AGCT	7 cut(s)	16, 262, 363, 541, 823, 910, 960
Alw21I	GWGCWC	2 cut(s)	18, 912
Alw26I	GTCTC	3 cut(s)	735, 809, 992
AlwI	GGATC	1 cut(s)	674
Ama87I	CYCGRG	2 cut(s)	17, 214
AoxI	GGCC	2 cut(s)	132, 264
ApeKI	GCWGC	3 cut(s)	128, 960, 1000
ApoI	RAATTY	4 cut(s)	100, 405, 785, 873
Asp700I	GAANNNNTTC	1 cut(s)	807
AspS9I	GGNCC	1 cut(s)	579
AvaI	CYCGRG	2 cut(s)	17, 214
AvaII	GGWCC	1 cut(s)	579
BalI	TGGCCA	1 cut(s)	266
BanII	GRGCYC	3 cut(s)	18, 24, 912
BauI	CACGAG	2 cut(s)	329, 989
BbsI	GAAGAC	1 cut(s)	884
Bbv12I	GWGCWC	2 cut(s)	18, 912
BbvI	GCAGC	3 cut(s)	115, 947, 987
BccI	CCATC	3 cut(s)	432, 741, 762
BceAI	ACGGC	1 cut(s)	275
BcgI	CGANNNNNNTGC	2 cut(s)	970, 1004
BciVI	GTATCC	1 cut(s)	628
BclI	TGATCA	1 cut(s)	853
BcoDI	GTCTC	3 cut(s)	735, 809, 992
BfaI	CTAG	2 cut(s)	89, 684
BfmI	CTRYAG	1 cut(s)	834
BfuI	GTATCC	1 cut(s)	628
BglII	AGATCT	2 cut(s)	346, 686
BisI	GCNGC	4 cut(s)	129, 132, 961, 1001
BlsI	GCNGC	4 cut(s)	130, 133, 962, 1002
Bme18I	GGWCC	1 cut(s)	579
BmeT110I	CYCGRG	2 cut(s)	17, 214
BmgT120I	GGNCC	1 cut(s)	579
BmiI	GGNNCC	2 cut(s)	94, 581
BmrI	ACTGGG	1 cut(s)	939
BmsI	GCATC	3 cut(s)	242, 538, 614
BmuI	ACTGGG	1 cut(s)	939
BpiI	GAAGAC	1 cut(s)	884
BpmI	CTGGAG	2 cut(s)	554, 833
BpuEI	CTTGAG	2 cut(s)	32, 478
BsaJI	CCNNGG	1 cut(s)	215
BsaXI	ACNNNNNCTCC	6 cut(s)	192, 195, 222, 225, 421, 451
Bsc4I	CCNNNNNNNGG	1 cut(s)	1020
Bse1I	ACTGG	5 cut(s)	11, 896, 934, 1001, 1067
BseDI	CCNNGG	1 cut(s)	215
BseGI	GGATG	2 cut(s)	424, 571
BseLI	CCNNNNNNNGG	1 cut(s)	1020
BseMII	CTCAG	4 cut(s)	291, 373, 833, 925
BseNI	ACTGG	5 cut(s)	11, 896, 934, 1001, 1067
BseRI	GAGGAG	1 cut(s)	200
BseX3I	CGGCCG	1 cut(s)	132
BseXI	GCAGC	3 cut(s)	115, 947, 987
BseYI	CCCAGC	1 cut(s)	115
Bsh1285I	CGRYCG	1 cut(s)	135
BshFI	GGCC	2 cut(s)	134, 266
BsiEI	CGRYCG	1 cut(s)	135
BsiHKAI	GWGCWC	2 cut(s)	18, 912
BsiHKCI	CYCGRG	2 cut(s)	17, 214
BslFI	GGGAC	2 cut(s)	565, 946
BslI	CCNNNNNNNGG	1 cut(s)	1020
BsmAI	GTCTC	3 cut(s)	735, 809, 992
BsmFI	GGGAC	2 cut(s)	565, 946
BsmI	GAATGC	1 cut(s)	872
BsnI	GGCC	2 cut(s)	134, 266
BsoBI	CYCGRG	2 cut(s)	17, 214
Bsp1286I	GDGCHC	3 cut(s)	18, 24, 912
Bsp143I	GATC	4 cut(s)	346, 679, 686, 853
BspACI	CCGC	4 cut(s)	113, 131, 195, 870
BspANI	GGCC	2 cut(s)	134, 266
BspCNI	CTCAG	4 cut(s)	292, 372, 832, 924
BspLI	GGNNCC	2 cut(s)	94, 581
BspMAI	CTGCAG	1 cut(s)	838
BspPI	GGATC	1 cut(s)	674
BsrBI	CCGCTC	1 cut(s)	197
BsrI	ACTGG	5 cut(s)	11, 896, 934, 1001, 1067
BssECI	CCNNGG	1 cut(s)	215
BssMI	GATC	4 cut(s)	346, 679, 686, 853
BssSI	CACGAG	2 cut(s)	329, 989
Bst2BI	CACGAG	2 cut(s)	329, 989
Bst4CI	ACNGT	4 cut(s)	81, 174, 287, 1050
Bst6I	CTCTTC	2 cut(s)	237, 813
BstAPI	GCANNNNNTGC	1 cut(s)	611
BstC8I	GCNNGC	2 cut(s)	264, 834
BstDEI	CTNAG	5 cut(s)	300, 359, 373, 819, 911
BstF5I	GGATG	2 cut(s)	424, 571
BstKTI	GATC	4 cut(s)	349, 682, 689, 856
BstMAI	GTCTC	3 cut(s)	735, 809, 992
BstMBI	GATC	4 cut(s)	346, 679, 686, 853
BstMCI	CGRYCG	1 cut(s)	135
BstMWI	GCNNNNNNNGC	3 cut(s)	112, 611, 829
BstNSI	RCATGY	2 cut(s)	398, 948
BstSFI	CTRYAG	1 cut(s)	834
BstV1I	GCAGC	3 cut(s)	115, 947, 987
BstV2I	GAAGAC	1 cut(s)	884
BstX2I	RGATCY	2 cut(s)	346, 686
BstYI	RGATCY	2 cut(s)	346, 686
BstZI	CGGCCG	1 cut(s)	132
BsuI	GTATCC	1 cut(s)	628
BsuRI	GGCC	2 cut(s)	134, 266
BtsCI	GGATG	2 cut(s)	424, 571
BtsIMutI	CAGTG	4 cut(s)	675, 1046, 1060, 1072
Cac8I	GCNNGC	2 cut(s)	264, 834
Cfr13I	GGNCC	1 cut(s)	579
Csp6I	GTAC	2 cut(s)	458, 714
CviAII	CATG	4 cut(s)	395, 658, 671, 945
CviQI	GTAC	2 cut(s)	458, 714
DdeI	CTNAG	5 cut(s)	300, 359, 373, 819, 911
DpnI	GATC	4 cut(s)	348, 681, 688, 855
DpnII	GATC	4 cut(s)	346, 679, 686, 853
DraI	TTTAAA	1 cut(s)	477
DrdI	GACNNNNNNGTC	1 cut(s)	553
DseDI	GACNNNNNNGTC	1 cut(s)	553
EaeI	YGGCCR	2 cut(s)	132, 264
EagI	CGGCCG	1 cut(s)	132
Eam1104I	CTCTTC	2 cut(s)	237, 813
EarI	CTCTTC	2 cut(s)	237, 813
Ecl136II	GAGCTC	2 cut(s)	16, 910
EclXI	CGGCCG	1 cut(s)	132
Eco24I	GRGCYC	3 cut(s)	18, 24, 912
Eco47I	GGWCC	1 cut(s)	579
Eco52I	CGGCCG	1 cut(s)	132
Eco53kI	GAGCTC	2 cut(s)	16, 910
Eco57I	CTGAAG	1 cut(s)	527
Eco88I	CYCGRG	2 cut(s)	17, 214
EcoICRI	GAGCTC	2 cut(s)	16, 910
EcoO109I	RGGNCCY	1 cut(s)	579
EcoT38I	GRGCYC	3 cut(s)	18, 24, 912
FaeI	CATG	4 cut(s)	398, 661, 674, 948
FaqI	GGGAC	2 cut(s)	565, 946
FatI	CATG	4 cut(s)	394, 657, 670, 944
FauNDI	CATATG	1 cut(s)	983
FbaI	TGATCA	1 cut(s)	853
FblI	GTMKAC	2 cut(s)	294, 557
Fnu4HI	GCNGC	4 cut(s)	129, 132, 961, 1001
FokI	GGATG	2 cut(s)	411, 578
FriOI	GRGCYC	3 cut(s)	18, 24, 912
Fsp4HI	GCNGC	4 cut(s)	129, 132, 961, 1001
FspBI	CTAG	2 cut(s)	89, 684
GluI	GCNGC	4 cut(s)	129, 132, 961, 1001
GsaI	CCCAGC	1 cut(s)	119
GsuI	CTGGAG	2 cut(s)	554, 833
HaeIII	GGCC	2 cut(s)	134, 266
Hin1II	CATG	4 cut(s)	398, 661, 674, 948
HindIII	AAGCTT	1 cut(s)	539
HinfI	GANTC	5 cut(s)	182, 207, 325, 817, 889
Hpy166II	GTNNAC	4 cut(s)	295, 558, 730, 994
Hpy188I	TCNGA	5 cut(s)	71, 301, 546, 888, 914
Hpy188III	TCNNGA	7 cut(s)	214, 331, 495, 533, 727, 800, 812
Hpy8I	GTNNAC	4 cut(s)	295, 558, 730, 994
Hpy99I	CGWCG	1 cut(s)	207
HpyAV	CCTTC	1 cut(s)	450
HpyCH4III	ACNGT	4 cut(s)	81, 174, 287, 1050
HpyCH4V	TGCA	5 cut(s)	255, 394, 836, 963, 1072
HpyF10VI	GCNNNNNNNGC	3 cut(s)	112, 611, 829
HpyF3I	CTNAG	5 cut(s)	300, 359, 373, 819, 911
Hsp92II	CATG	4 cut(s)	398, 661, 674, 948
Ksp22I	TGATCA	1 cut(s)	853
Kzo9I	GATC	4 cut(s)	346, 679, 686, 853
LmnI	GCTCC	1 cut(s)	889
Lsp1109I	GCAGC	3 cut(s)	115, 947, 987
LweI	GCATC	3 cut(s)	242, 538, 614
MaeI	CTAG	2 cut(s)	89, 684
MalI	GATC	4 cut(s)	348, 681, 688, 855
MbiI	CCGCTC	1 cut(s)	197
MboI	GATC	4 cut(s)	346, 679, 686, 853
MboII	GAAGA	4 cut(s)	254, 800, 859, 884
MfeI	CAATTG	1 cut(s)	410
MflI	RGATCY	2 cut(s)	346, 686
MhlI	GDGCHC	3 cut(s)	18, 24, 912
MlsI	TGGCCA	1 cut(s)	266
MluCI	AATT	7 cut(s)	100, 405, 410, 444, 472, 785, 873
MluNI	TGGCCA	1 cut(s)	266
MlyI	GAGTC	4 cut(s)	176, 201, 811, 898
Mox20I	TGGCCA	1 cut(s)	266
MroXI	GAANNNNTTC	1 cut(s)	807
MscI	TGGCCA	1 cut(s)	266
MseI	TTAA	4 cut(s)	471, 476, 795, 1032
MslI	CAYNNNNRTG	1 cut(s)	165
Msp20I	TGGCCA	1 cut(s)	266
MspA1I	CMGCKG	2 cut(s)	115, 960
MunI	CAATTG	1 cut(s)	410
Mva1269I	GAATGC	1 cut(s)	872
MwoI	GCNNNNNNNGC	3 cut(s)	112, 611, 829
NdeI	CATATG	1 cut(s)	983
NdeII	GATC	4 cut(s)	346, 679, 686, 853
NlaIII	CATG	4 cut(s)	398, 661, 674, 948
NlaIV	GGNNCC	2 cut(s)	94, 581
NspI	RCATGY	2 cut(s)	398, 948
PaeR7I	CTCGAG	1 cut(s)	17
PctI	GAATGC	1 cut(s)	872
PdmI	GAANNNNTTC	1 cut(s)	807
PfeI	GAWTC	1 cut(s)	325
PkrI	GCNGC	4 cut(s)	130, 133, 962, 1002
PleI	GAGTC	4 cut(s)	176, 201, 811, 897
PpsI	GAGTC	4 cut(s)	176, 201, 811, 897
PpuMI	RGGWCCY	1 cut(s)	579
Psp124BI	GAGCTC	2 cut(s)	18, 912
Psp5II	RGGWCCY	1 cut(s)	579
PspFI	CCCAGC	1 cut(s)	115
PspN4I	GGNNCC	2 cut(s)	94, 581
PspPI	GGNCC	1 cut(s)	579
PspPPI	RGGWCCY	1 cut(s)	579
PspXI	VCTCGAGB	1 cut(s)	17
PstI	CTGCAG	1 cut(s)	838
PsuI	RGATCY	2 cut(s)	346, 686
PvuII	CAGCTG	1 cut(s)	960
RsaI	GTAC	2 cut(s)	459, 715
RsaNI	GTAC	2 cut(s)	458, 714
RseI	CAYNNNNRTG	1 cut(s)	165
SacI	GAGCTC	2 cut(s)	18, 912
SaqAI	TTAA	4 cut(s)	471, 476, 795, 1032
SatI	GCNGC	4 cut(s)	129, 132, 961, 1001
Sau3AI	GATC	4 cut(s)	346, 679, 686, 853
Sau96I	GGNCC	1 cut(s)	579
SchI	GAGTC	4 cut(s)	176, 201, 811, 898
SduI	GDGCHC	3 cut(s)	18, 24, 912
SfaNI	GCATC	3 cut(s)	242, 538, 614
SfcI	CTRYAG	1 cut(s)	834
Sfr274I	CTCGAG	1 cut(s)	17
SinI	GGWCC	1 cut(s)	579
SlaI	CTCGAG	1 cut(s)	17
SmiMI	CAYNNNNRTG	1 cut(s)	165
SmlI	CTYRAG	3 cut(s)	11, 17, 493
SmoI	CTYRAG	3 cut(s)	11, 17, 493
Sse9I	AATT	7 cut(s)	100, 405, 410, 444, 472, 785, 873
SsiI	CCGC	4 cut(s)	113, 131, 195, 870
SspMI	CTAG	2 cut(s)	89, 684
SstI	GAGCTC	2 cut(s)	18, 912
TaaI	ACNGT	4 cut(s)	81, 174, 287, 1050
TaqI	TCGA	4 cut(s)	18, 221, 488, 801
TasI	AATT	7 cut(s)	100, 405, 410, 444, 472, 785, 873
TauI	GCSGC	1 cut(s)	134
TfiI	GAWTC	1 cut(s)	325
Tru1I	TTAA	4 cut(s)	471, 476, 795, 1032
Tru9I	TTAA	4 cut(s)	471, 476, 795, 1032
TscAI	CASTG	3 cut(s)	682, 1053, 1067
TseI	GCWGC	3 cut(s)	128, 960, 1000
TspDTI	ATGAA	3 cut(s)	183, 659, 965
TspRI	CASTG	3 cut(s)	682, 1053, 1067
VpaK11BI	GGWCC	1 cut(s)	579
XapI	RAATTY	4 cut(s)	100, 405, 785, 873
XceI	RCATGY	2 cut(s)	398, 948
XhoI	CTCGAG	1 cut(s)	17
XmiI	GTMKAC	2 cut(s)	294, 557
XmnI	GAANNNNTTC	1 cut(s)	807
XspI	CTAG	2 cut(s)	89, 684

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.