Rorug07G0270600

E3 ubiquitin-protein ligase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0004363
Physical Location & Seq
Reverse (-)
25564274 .. 25564639
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0270600.1

Sequence Viewer

Length: 366 bp
ATGAGCAATATGCAAAGCCTGGAGACACTGAATCTTTCACATAATAAACTTTCTGGTCTCATTCCAACATCTTTTGATGAAATGCCTCGCTTGCTGTACATCGACATATCCTACAATCAGTTGCAGGGTCCCATTCCAAACAACAAAGCATTTCAAGATTCTACCTTGGATGGGAATAAAGGATTGTCTAGTGATGTTGTTAGAAGACTTCAGCCCTGTAAGAATATCACTAAATTCAGTCGAAAATCTGTAGTCATAATCATTTTTGTTTCCTTGGGAGCTCTTTCACTTGCTCTCCTTGGAATTGTAACGATTGTTAGATCAATAAAGAAGAAAGAGCAGCAACCAAAGCAGCATGATATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03460 ko04120 map03460 map04120
Pfam Domains
Protein Families
FANCL_C WD-3

Protein Analysis

121

Amino Acids

13.53

Weight (kDa)

9.72

Isoelectric Point (pI)

52.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_8 PF13855 2 - 41 7e-10 Leucine rich repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 233
AcuI CTGAAG 1 cut(s) 194
AfaI GTAC 1 cut(s) 98
AfiI CCNNNNNNNGG 1 cut(s) 171
AgsI TTSAA 1 cut(s) 155
AjnI CCWGG 1 cut(s) 18
AluBI AGCT 1 cut(s) 281
AluI AGCT 1 cut(s) 281
Alw21I GWGCWC 1 cut(s) 283
Alw26I GTCTC 2 cut(s) 17, 62
ApeKI GCWGC 2 cut(s) 340, 352
ApoI RAATTY 1 cut(s) 233
AspS9I GGNCC 1 cut(s) 128
AvaII GGWCC 1 cut(s) 128
BanII GRGCYC 1 cut(s) 283
BbsI GAAGAC 1 cut(s) 211
Bbv12I GWGCWC 1 cut(s) 283
BbvI GCAGC 1 cut(s) 352
BccI CCATC 1 cut(s) 164
BciT130I CCWGG 1 cut(s) 20
BcoDI GTCTC 2 cut(s) 17, 62
BfaI CTAG 1 cut(s) 189
BfmI CTRYAG 1 cut(s) 249
BisI GCNGC 2 cut(s) 341, 353
BlsI GCNGC 2 cut(s) 342, 354
Bme1390I CCNGG 1 cut(s) 20
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 128
BmiI GGNNCC 2 cut(s) 129, 130
BmrFI CCNGG 1 cut(s) 20
BpiI GAAGAC 1 cut(s) 211
BpmI CTGGAG 1 cut(s) 41
BsaI GGTCTC 1 cut(s) 62
BsaJI CCNNGG 3 cut(s) 165, 273, 298
BsaXI ACNNNNNCTCC 2 cut(s) 279, 309
Bsc4I CCNNNNNNNGG 1 cut(s) 171
BseBI CCWGG 1 cut(s) 20
BseDI CCNNGG 3 cut(s) 165, 273, 298
BseGI GGATG 1 cut(s) 175
BseLI CCNNNNNNNGG 1 cut(s) 171
BseXI GCAGC 1 cut(s) 352
BsiHKAI GWGCWC 1 cut(s) 283
BslFI GGGAC 1 cut(s) 114
BslI CCNNNNNNNGG 1 cut(s) 171
BsmAI GTCTC 2 cut(s) 17, 62
BsmFI GGGAC 1 cut(s) 114
Bso31I GGTCTC 1 cut(s) 62
Bsp1286I GDGCHC 1 cut(s) 283
Bsp1407I TGTACA 1 cut(s) 96
Bsp143I GATC 1 cut(s) 320
BspLI GGNNCC 2 cut(s) 129, 130
BspTNI GGTCTC 1 cut(s) 62
BsrGI TGTACA 1 cut(s) 96
BssECI CCNNGG 3 cut(s) 165, 273, 298
BssMI GATC 1 cut(s) 320
BssT1I CCWWGG 3 cut(s) 165, 273, 298
Bst2UI CCWGG 1 cut(s) 20
BstAUI TGTACA 1 cut(s) 96
BstC8I GCNNGC 1 cut(s) 92
BstF5I GGATG 1 cut(s) 175
BstKTI GATC 1 cut(s) 323
BstMAI GTCTC 2 cut(s) 17, 62
BstMBI GATC 1 cut(s) 320
BstMWI GCNNNNNNNGC 2 cut(s) 91, 349
BstNI CCWGG 1 cut(s) 20
BstSCI CCNGG 1 cut(s) 18
BstSFI CTRYAG 1 cut(s) 249
BstV1I GCAGC 1 cut(s) 352
BstV2I GAAGAC 1 cut(s) 211
BtsCI GGATG 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 26
Cac8I GCNNGC 1 cut(s) 92
Cfr13I GGNCC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 97
CviAII CATG 1 cut(s) 356
CviJI RGCY 3 cut(s) 18, 214, 281
CviKI_1 RGCY 3 cut(s) 18, 214, 281
CviQI GTAC 1 cut(s) 97
DpnI GATC 1 cut(s) 322
DpnII GATC 1 cut(s) 320
Ecl136II GAGCTC 1 cut(s) 281
Eco130I CCWWGG 3 cut(s) 165, 273, 298
Eco24I GRGCYC 1 cut(s) 283
Eco31I GGTCTC 1 cut(s) 62
Eco47I GGWCC 1 cut(s) 128
Eco53kI GAGCTC 1 cut(s) 281
Eco57I CTGAAG 1 cut(s) 194
EcoICRI GAGCTC 1 cut(s) 281
EcoO109I RGGNCCY 1 cut(s) 128
EcoRII CCWGG 1 cut(s) 18
EcoT14I CCWWGG 3 cut(s) 165, 273, 298
EcoT38I GRGCYC 1 cut(s) 283
ErhI CCWWGG 3 cut(s) 165, 273, 298
FaeI CATG 1 cut(s) 359
FaiI YATR 6 cut(s) 11, 42, 107, 257, 357, 362
FaqI GGGAC 1 cut(s) 114
FatI CATG 1 cut(s) 355
Fnu4HI GCNGC 2 cut(s) 341, 353
FokI GGATG 1 cut(s) 182
FriOI GRGCYC 1 cut(s) 283
Fsp4HI GCNGC 2 cut(s) 341, 353
FspBI CTAG 1 cut(s) 189
GluI GCNGC 2 cut(s) 341, 353
GsuI CTGGAG 1 cut(s) 41
Hin1II CATG 1 cut(s) 359
HinfI GANTC 2 cut(s) 31, 158
Hpy188III TCNNGA 1 cut(s) 155
HpyCH4V TGCA 2 cut(s) 13, 124
HpyF10VI GCNNNNNNNGC 2 cut(s) 91, 349
Hsp92II CATG 1 cut(s) 359
KflI GGGWCCC 1 cut(s) 128
Kzo9I GATC 1 cut(s) 320
LmnI GCTCC 1 cut(s) 278
LpnPI CCDG 5 cut(s) 5, 32, 39, 110, 229
Lsp1109I GCAGC 1 cut(s) 352
MaeI CTAG 1 cut(s) 189
MaeIII GTNAC 1 cut(s) 307
MalI GATC 1 cut(s) 322
MboI GATC 1 cut(s) 320
MboII GAAGA 2 cut(s) 216, 343
MhlI GDGCHC 1 cut(s) 283
MluCI AATT 2 cut(s) 233, 303
MmeI TCCRAC 1 cut(s) 89
MnlI CCTC 1 cut(s) 96
MspR9I CCNGG 1 cut(s) 20
MvaI CCWGG 1 cut(s) 20
MwoI GCNNNNNNNGC 2 cut(s) 91, 349
NdeII GATC 1 cut(s) 320
NlaIII CATG 1 cut(s) 359
NlaIV GGNNCC 2 cut(s) 129, 130
PfeI GAWTC 2 cut(s) 31, 158
PkrI GCNGC 2 cut(s) 342, 354
PpuMI RGGWCCY 1 cut(s) 128
Psp124BI GAGCTC 1 cut(s) 283
Psp5II RGGWCCY 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 18
PspGI CCWGG 1 cut(s) 18
PspN4I GGNNCC 2 cut(s) 129, 130
PspPI GGNCC 1 cut(s) 128
PspPPI RGGWCCY 1 cut(s) 128
RsaI GTAC 1 cut(s) 98
RsaNI GTAC 1 cut(s) 97
SacI GAGCTC 1 cut(s) 283
SatI GCNGC 2 cut(s) 341, 353
Sau3AI GATC 1 cut(s) 320
Sau96I GGNCC 1 cut(s) 128
ScrFI CCNGG 1 cut(s) 20
SduI GDGCHC 1 cut(s) 283
SetI ASST 2 cut(s) 167, 283
SfcI CTRYAG 1 cut(s) 249
SinI GGWCC 1 cut(s) 128
Sse9I AATT 2 cut(s) 233, 303
SspMI CTAG 1 cut(s) 189
SstI GAGCTC 1 cut(s) 283
StyD4I CCNGG 1 cut(s) 18
StyI CCWWGG 3 cut(s) 165, 273, 298
TaqI TCGA 2 cut(s) 102, 241
TasI AATT 2 cut(s) 233, 303
TatI WGTACW 1 cut(s) 96
TfiI GAWTC 2 cut(s) 31, 158
TscAI CASTG 1 cut(s) 33
TseI GCWGC 2 cut(s) 340, 352
TspDTI ATGAA 1 cut(s) 93
TspRI CASTG 1 cut(s) 33
VpaK11BI GGWCC 1 cut(s) 128
XapI RAATTY 1 cut(s) 233
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.