Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001811.1

Orthogroup ID

OG0007665

Physical Location & Seq

Genomic Coordinates Forward (+)

28036 .. 34864

Gene Structure 6829 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001811.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1152 bp

atgcaaacaaagcccaaatctgagaaacttgggctacatggtttcgcactcataaccaaaccgctcgaaaagggttcgccggtttcgggatttgcagcggctgttcagcttcaaaggaggagtctttatccggtggttgttattatcaagatggtggtgcttactgcagcaagtgcaattgctagctcacctctactgccagcagggtcagtgggtcaacagggcagacgagctggggtttatgggtccggtccaagaagagtttgtgtggatagaagtgtggtacgctctgacattagaccagtgggacttggcacacggttatcgcttgagagaagaaaaccattatcaccaatcacggggtctcgtcgaacgcagtctgcttctgtaatatgtgcttcttctttgaatgccagatgcggtgcagagcaaacgcaaactgttacacgtgaggctccaacaattacacatcttcctggcaaggaaaaatctccgctgcttgatgatggcggaacaggattccctcccagagatgatggtggtggtggtggcggtgggggtggtggtggaggcaactggtcgggaggcttcgcgttttttggatttcttcttttcctcagctttctaaaggataaagaaagtgaaggttcagcaggtcaaagacatagacaagctgggctttatgggtctggttcaagaagagcttgtgttgatagaagcgtggtacattttcagatgagaccggtggggataggtggagggttgtcacttgagacaagaaaaccaatcacaacaatcgtggggtctagtcgaatgcagtctgcttctgtaatatgtgcttctgctttgaaaattcacataatagttgatgaaattacagagaagaggaattccctgcatcataagcttgatgatagtggtaaaccgcctcgtaacaagggaaatgatgacggtggtggtaataatgggaggggtcgacctccaaacaacggaggatcagaaggcttcatttttttcggctttcttcttttcctgagctacttgaaggatttagaaaacgagggttcttatcgagaaaacctgagctacttgaaggatttagaaaacgagggttcttatcgagaaaaaaggacaggaggtcatggtcattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

383

Amino Acids

40.6

Weight (kDa)

9.98

Isoelectric Point (pI)

46.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007665)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G30475 AT1G30475 AT1G30475 AT1G30475 AT1G56200 AT1G56200
fragaria_vesca	FvH4_3g42270 FvH4_3g42270 FvH4_3g42270 FvH4_3g42270 FvH4_3g42270
malus_domestica	MD03G1035300.v1.1 MD11G1037000.v1.1
prunus_persica	Prupe.6G028300_v2.0.a1 Prupe.6G028300_v2.0.a1
pyrus_communis	pycom03g02750 pycom11g03070
rosa_chinensis	RchiOBHm_Chr5g0075591
rosa_laevigata	RLG00000036583
rosa_multiflora	Rmu_sc0001811.1_g000004
rosa_roxburghii	Rroxscaffold_1G00005970
rosa_rugosa	Rorug05G0441500
rosa_samantha	Rh5BG518900
rosa_wichuraiana	Rw5G046180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	644
AccBSI	CCGCTC	1 cut(s)	64
AccI	GTMKAC	1 cut(s)	976
AccII	CGCG	1 cut(s)	593
AciI	CCGC	7 cut(s)	62, 98, 420, 494, 510, 552, 926
AclWI	GGATC	1 cut(s)	1003
AcsI	RAATTY	2 cut(s)	852, 889
AcvI	CACGTG	1 cut(s)	449
AfaI	GTAC	2 cut(s)	285, 726
AfiI	CCNNNNNNNGG	3 cut(s)	86, 359, 989
AflIII	ACRYGT	1 cut(s)	446
AgeI	ACCGGT	1 cut(s)	742
AgsI	TTSAA	6 cut(s)	113, 409, 696, 850, 1045, 1093
AhdI	GACNNNNNGTC	1 cut(s)	1137
AjnI	CCWGG	1 cut(s)	475
AluBI	AGCT	9 cut(s)	109, 186, 233, 621, 674, 704, 907, 1038, 1086
AluI	AGCT	9 cut(s)	109, 186, 233, 621, 674, 704, 907, 1038, 1086
Alw26I	GTCTC	3 cut(s)	369, 733, 767
AlwI	GGATC	1 cut(s)	1003
AlwNI	CAGNNNCTG	1 cut(s)	101
ApeKI	GCWGC	3 cut(s)	95, 167, 496
ApoI	RAATTY	2 cut(s)	852, 889
ArsI	GACNNNNNNTTYG	2 cut(s)	106, 138
AsiGI	ACCGGT	1 cut(s)	742
AspS9I	GGNCC	2 cut(s)	246, 251
AsuHPI	GGTGA	2 cut(s)	180, 342
AsuNHI	GCTAGC	1 cut(s)	182
AvaII	GGWCC	2 cut(s)	246, 251
BbrPI	CACGTG	1 cut(s)	449
BbvCI	CCTCAGC	1 cut(s)	617
BbvI	GCAGC	3 cut(s)	107, 179, 483
BccI	CCATC	3 cut(s)	145, 500, 530
BciT130I	CCWGG	1 cut(s)	477
BcoDI	GTCTC	3 cut(s)	369, 733, 767
BfaI	CTAG	2 cut(s)	183, 807
BfmI	CTRYAG	1 cut(s)	165
BfuAI	ACCTGC	1 cut(s)	644
BisI	GCNGC	4 cut(s)	96, 99, 168, 497
BlsI	GCNGC	4 cut(s)	97, 100, 169, 498
Bme1390I	CCNGG	1 cut(s)	477
Bme18I	GGWCC	2 cut(s)	246, 251
BmeRI	GACNNNNNGTC	1 cut(s)	1137
BmgT120I	GGNCC	2 cut(s)	246, 251
BmiI	GGNNCC	2 cut(s)	247, 456
BmrFI	CCNGG	1 cut(s)	477
BmsI	GCATC	2 cut(s)	407, 907
BmtI	GCTAGC	1 cut(s)	186
Bpu10I	CCTNAGC	3 cut(s)	617, 1034, 1082
BpuEI	CTTGAG	2 cut(s)	350, 791
BsaAI	YACGTR	1 cut(s)	449
BsaI	GGTCTC	2 cut(s)	369, 733
BsaWI	WCCGGW	3 cut(s)	130, 248, 742
Bsc4I	CCNNNNNNNGG	3 cut(s)	86, 359, 989
Bse118I	RCCGGY	2 cut(s)	79, 742
Bse1I	ACTGG	2 cut(s)	302, 581
BseBI	CCWGG	1 cut(s)	477
BseLI	CCNNNNNNNGG	3 cut(s)	86, 359, 989
BseMII	CTCAG	4 cut(s)	12, 631, 1025, 1073
BseNI	ACTGG	2 cut(s)	302, 581
BseRI	GAGGAG	1 cut(s)	133
BseXI	GCAGC	3 cut(s)	107, 179, 483
BseYI	CCCAGC	2 cut(s)	233, 674
BsgI	GTGCAG	1 cut(s)	444
Bsh1236I	CGCG	1 cut(s)	593
BshTI	ACCGGT	1 cut(s)	742
BsiSI	CCGG	4 cut(s)	80, 131, 249, 743
BslFI	GGGAC	1 cut(s)	321
BslI	CCNNNNNNNGG	3 cut(s)	86, 359, 989
BsmAI	GTCTC	3 cut(s)	369, 733, 767
BsmFI	GGGAC	1 cut(s)	321
BsmI	GAATGC	2 cut(s)	415, 819
Bso31I	GGTCTC	2 cut(s)	369, 733
Bsp143I	GATC	1 cut(s)	995
BspACI	CCGC	7 cut(s)	62, 98, 420, 494, 510, 552, 926
BspCNI	CTCAG	4 cut(s)	13, 630, 1026, 1074
BspFNI	CGCG	1 cut(s)	593
BspLI	GGNNCC	2 cut(s)	247, 456
BspMAI	CTGCAG	1 cut(s)	169
BspMI	ACCTGC	1 cut(s)	644
BspOI	GCTAGC	1 cut(s)	186
BspPI	GGATC	1 cut(s)	1003
BspQI	GCTCTTC	1 cut(s)	694
BspTNI	GGTCTC	2 cut(s)	369, 733
BsrBI	CCGCTC	1 cut(s)	64
BsrFI	RCCGGY	2 cut(s)	79, 742
BsrI	ACTGG	2 cut(s)	302, 581
BssAI	RCCGGY	2 cut(s)	79, 742
BssMI	GATC	1 cut(s)	995
Bst2UI	CCWGG	1 cut(s)	477
Bst4CI	ACNGT	3 cut(s)	321, 442, 953
Bst6I	CTCTTC	3 cut(s)	253, 694, 878
BstAPI	GCANNNNNTGC	1 cut(s)	173
BstBAI	YACGTR	1 cut(s)	449
BstC8I	GCNNGC	2 cut(s)	184, 201
BstDEI	CTNAG	4 cut(s)	21, 617, 1034, 1082
BstFNI	CGCG	1 cut(s)	593
BstKTI	GATC	1 cut(s)	998
BstMAI	GTCTC	3 cut(s)	369, 733, 767
BstMBI	GATC	1 cut(s)	995
BstMWI	GCNNNNNNNGC	3 cut(s)	10, 173, 904
BstNI	CCWGG	1 cut(s)	477
BstSCI	CCNGG	1 cut(s)	475
BstSFI	CTRYAG	1 cut(s)	165
BstUI	CGCG	1 cut(s)	593
BstV1I	GCAGC	3 cut(s)	107, 179, 483
BtsIMutI	CAGTG	2 cut(s)	216, 309
BveI	ACCTGC	1 cut(s)	644
Cac8I	GCNNGC	2 cut(s)	184, 201
CaiI	CAGNNNCTG	1 cut(s)	101
Cfr10I	RCCGGY	2 cut(s)	79, 742
Cfr13I	GGNCC	2 cut(s)	246, 251
Csp6I	GTAC	2 cut(s)	284, 725
CspAI	ACCGGT	1 cut(s)	742
CspCI	CAANNNNNGTGG	2 cut(s)	780, 815
CviAII	CATG	2 cut(s)	38, 1142
CviQI	GTAC	2 cut(s)	284, 725
DdeI	CTNAG	4 cut(s)	21, 617, 1034, 1082
DpnI	GATC	1 cut(s)	997
DpnII	GATC	1 cut(s)	995
DriI	GACNNNNNGTC	1 cut(s)	1137
Eam1104I	CTCTTC	3 cut(s)	253, 694, 878
Eam1105I	GACNNNNNGTC	1 cut(s)	1137
EarI	CTCTTC	3 cut(s)	253, 694, 878
EciI	GGCGGA	1 cut(s)	525
Eco31I	GGTCTC	2 cut(s)	369, 733
Eco47I	GGWCC	2 cut(s)	246, 251
Eco72I	CACGTG	1 cut(s)	449
EcoRI	GAATTC	1 cut(s)	889
EcoRII	CCWGG	1 cut(s)	475
FaeI	CATG	2 cut(s)	41, 1145
FalI	AAGNNNNNCTT	4 cut(s)	663, 695, 688, 720
FaqI	GGGAC	1 cut(s)	321
FatI	CATG	2 cut(s)	37, 1141
FblI	GTMKAC	1 cut(s)	976
Fnu4HI	GCNGC	4 cut(s)	96, 99, 168, 497
Fsp4HI	GCNGC	4 cut(s)	96, 99, 168, 497
FspBI	CTAG	2 cut(s)	183, 807
GluI	GCNGC	4 cut(s)	96, 99, 168, 497
GsaI	CCCAGC	2 cut(s)	237, 678
HapII	CCGG	4 cut(s)	80, 131, 249, 743
Hin1II	CATG	2 cut(s)	41, 1145
HincII	GTYRAC	2 cut(s)	218, 977
HindII	GTYRAC	2 cut(s)	218, 977
HindIII	AAGCTT	1 cut(s)	905
HinfI	GANTC	2 cut(s)	121, 519
HpaII	CCGG	4 cut(s)	80, 131, 249, 743
HphI	GGTGA	2 cut(s)	180, 342
Hpy166II	GTNNAC	3 cut(s)	218, 923, 977
Hpy188I	TCNGA	4 cut(s)	22, 292, 735, 1000
Hpy188III	TCNNGA	7 cut(s)	87, 148, 582, 696, 1033, 1073, 1121
Hpy8I	GTNNAC	3 cut(s)	218, 923, 977
Hpy99I	CGWCG	1 cut(s)	372
HpyAV	CCTTC	4 cut(s)	638, 995, 1039, 1087
HpyCH4III	ACNGT	3 cut(s)	321, 442, 953
HpyCH4IV	ACGT	1 cut(s)	448
HpyCH4V	TGCA	7 cut(s)	4, 95, 167, 176, 425, 817, 898
HpyF10VI	GCNNNNNNNGC	3 cut(s)	10, 173, 904
HpyF3I	CTNAG	4 cut(s)	21, 617, 1034, 1082
HpySE526I	ACGT	1 cut(s)	448
Hsp92II	CATG	2 cut(s)	41, 1145
Kzo9I	GATC	1 cut(s)	995
LguI	GCTCTTC	1 cut(s)	694
LmnI	GCTCC	1 cut(s)	460
Lsp1109I	GCAGC	3 cut(s)	107, 179, 483
LweI	GCATC	2 cut(s)	407, 907
MaeI	CTAG	2 cut(s)	183, 807
MaeII	ACGT	1 cut(s)	448
MaeIII	GTNAC	3 cut(s)	442, 765, 932
MalI	GATC	1 cut(s)	997
MbiI	CCGCTC	1 cut(s)	64
MboI	GATC	1 cut(s)	995
MboII	GAAGA	8 cut(s)	270, 348, 393, 464, 599, 711, 895, 1016
MfeI	CAATTG	1 cut(s)	177
MluCI	AATT	5 cut(s)	177, 462, 852, 873, 889
MlyI	GAGTC	1 cut(s)	130
MmeI	TCCRAC	1 cut(s)	482
MspA1I	CMGCKG	2 cut(s)	98, 496
MspI	CCGG	4 cut(s)	80, 131, 249, 743
MspR9I	CCNGG	1 cut(s)	477
MunI	CAATTG	1 cut(s)	177
Mva1269I	GAATGC	2 cut(s)	415, 819
MvaI	CCWGG	1 cut(s)	477
MvnI	CGCG	1 cut(s)	593
MwoI	GCNNNNNNNGC	3 cut(s)	10, 173, 904
NdeII	GATC	1 cut(s)	995
NheI	GCTAGC	1 cut(s)	182
NlaIII	CATG	2 cut(s)	41, 1145
NlaIV	GGNNCC	2 cut(s)	247, 456
NmuCI	GTSAC	1 cut(s)	765
PciSI	GCTCTTC	1 cut(s)	694
PctI	GAATGC	2 cut(s)	415, 819
PfeI	GAWTC	1 cut(s)	519
PinAI	ACCGGT	1 cut(s)	742
PkrI	GCNGC	4 cut(s)	97, 100, 169, 498
PleI	GAGTC	1 cut(s)	129
PmaCI	CACGTG	1 cut(s)	449
PmlI	CACGTG	1 cut(s)	449
PpsI	GAGTC	1 cut(s)	129
Ppu21I	YACGTR	1 cut(s)	449
Psp6I	CCWGG	1 cut(s)	475
PspCI	CACGTG	1 cut(s)	449
PspFI	CCCAGC	2 cut(s)	233, 674
PspGI	CCWGG	1 cut(s)	475
PspN4I	GGNNCC	2 cut(s)	247, 456
PspPI	GGNCC	2 cut(s)	246, 251
PstI	CTGCAG	1 cut(s)	169
PstNI	CAGNNNCTG	1 cut(s)	101
RsaI	GTAC	2 cut(s)	285, 726
RsaNI	GTAC	2 cut(s)	284, 725
SalI	GTCGAC	1 cut(s)	975
SapI	GCTCTTC	1 cut(s)	694
SatI	GCNGC	4 cut(s)	96, 99, 168, 497
Sau3AI	GATC	1 cut(s)	995
Sau96I	GGNCC	2 cut(s)	246, 251
SchI	GAGTC	1 cut(s)	130
ScrFI	CCNGG	1 cut(s)	477
SfaNI	GCATC	2 cut(s)	407, 907
SfcI	CTRYAG	1 cut(s)	165
SinI	GGWCC	2 cut(s)	246, 251
SmlI	CTYRAG	2 cut(s)	329, 770
SmoI	CTYRAG	2 cut(s)	329, 770
Sse9I	AATT	5 cut(s)	177, 462, 852, 873, 889
SsiI	CCGC	7 cut(s)	62, 98, 420, 494, 510, 552, 926
SspMI	CTAG	2 cut(s)	183, 807
StyD4I	CCNGG	1 cut(s)	475
TaaI	ACNGT	3 cut(s)	321, 442, 953
TaiI	ACGT	1 cut(s)	451
TaqI	TCGA	6 cut(s)	66, 370, 811, 976, 1072, 1120
TasI	AATT	5 cut(s)	177, 462, 852, 873, 889
TauI	GCSGC	1 cut(s)	101
TfiI	GAWTC	1 cut(s)	519
TscAI	CASTG	2 cut(s)	216, 309
TseFI	GTSAC	1 cut(s)	765
TseI	GCWGC	3 cut(s)	95, 167, 496
Tsp45I	GTSAC	1 cut(s)	765
TspDTI	ATGAA	2 cut(s)	885, 997
TspGWI	ACGGA	1 cut(s)	1005
TspRI	CASTG	2 cut(s)	216, 309
VpaK11BI	GGWCC	2 cut(s)	246, 251
XapI	RAATTY	2 cut(s)	852, 889
XmiI	GTMKAC	1 cut(s)	976
XspI	CTAG	2 cut(s)	183, 807

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.