Rmu_sc0001986.1_g000006

chromatin binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001986.1
Physical Location & Seq
Forward (+)
21464 .. 28676
7213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001986.1_g000006.1.cds

Sequence Viewer

Length: 4038 bp
atgggtgtttcgtttaaggtctcaaagaacggtaccaggttccgtcccaagcctcctctcccctccgagaccaacgttgttgccgatgacgtgtccgagatcaatgcctcctccaattctcggaagctccaggttgaaagaaaggagaatgtggctggtatgtctggttcttcagagtcctctgaagtgctgctcgtatctgcagagactgaggcttccttcacgttaaatctcttcccagatggatattcaattggaaaaccgtctgagaatgagaatgctcatcaagatgttccgaagctgctgcacccatatgataggacatcagaaactctcttctcggcaattgaatctggtcggttgcctggagatattttagatgatattccttgcaagtacattgatggaacacttgtgtgtgaggttcgagattatcgtaaatgtgcttttgaacaaggggccgccagtccgcctactgacggatcccttatcgtaaataaggtccgcctcagaatgtcactggaaaatgtagtgaaggatatccccctgatctcggataattcttggagttatggtgatctgatggaagtagagtctcgtatattgaaagctttgcaaccacaacttcatctagatcccactcccaagttggatagactatgtaggaatccaactcccacaaagcttgatttggctttgaccagtatacggagaaagaggttgaggccgatgccagaagttactgttacatctaacagcaagacacatggaaagaaagtttgcatagatagagttccagaaagttctaatagtaggttgggagattcaggaatccttgcaggcaatatgacgccacaccaaggccatgaaaatttgatcactcaaaatttgagcgcgaataacatcgccttaagatctaaaaattttatgcctgatgtttctgttccagcaccacaccaatcaaggtatcaaatgggggtcgggactccaagaaatatgcaggaccatggatcaggacctgttgtcaatgtgtcagcttcccctggtggacaggagatgatgatctcgtatgctgacaatggtacctccaatgcctctcatcctggaaagagagagcatcaagatgggccaatgtcacctttatctttcaataagagaccgaggtcctcagcagctggccttgatgcaatgcaacatcagcaaatagggcctatagacagcttcaatggatcagatatgaattggaagaatccattgttgcagcatcctattgccaaaggtatccaatatccaaatacaggaactcagaaactttccccccaggtgtttgaaggggcactgaatcaagatacagggactatgccgttcgctgtaggacagtcaaacatgagatttggtgccaaggacgagcagtttgagacaggtaaagtagaagggtcagagctcagtgggattaagaatgatatgcagatggtggaaggagaaacaagccatcttgacccgcagctatcacgatttccacaaagattaccacagcattcattcatgagatccagttattctcaggcaccctggaataaccttggtcaaaatattgagaaagatgcaagaaaggatgaccaactctccaaaagaaaaccagtgcaaagtccccggttatctgctggggctacggttcagtctccattatcatcaaaatcagcggagttttctactggttctgtaggaccccactttggagtcggagctaattctgcctttggggcatcacagaaggaaaaggcagcaatgagctcagttactggtattggaactccatctttgacttccagtgctaatgaatccatgcaaaggcaacaccaggctcatgttgctgcaaaacggaaatcgaactccctccctaaaacctcagcaatgagtggtgtcggatctccggccagtgttagtaatataagtatgccattaaatgcgaatagtccctctgttggaactccatcttcggctgaccaaagcatgcttgaaagattgtcaaaaattgaacaagtgaccatgaggtatcaactcaacggaagaaagagtaaggttgataactactctaggaagcccaattcatatccagctcaaaatcttatggcttgtctctcaaatgtttcgaataatgaagattttaaagatgattcatgtatgagccctttatcgaagtcgcttgttggtggcagcatgaatatctgcaagaccagaattttaaattttgtggagcaagttcaaggaactggtttttcttatgttcctaaggcacgaacgaggatgatcatgtcagagaagccaaatgatggtactgtagcaatgtaccatggcgaaatagaggatagtgaatttctagctgcggaggattatcttcctacgttgcccaatactcatttggctgatttgcttgcagcacagttctgttcactgatggtacatgatgggtatagtcttatggaagatcatatccaaccaaagccaacccgcatgtatcttcccccaggcaataatggtgctggtttgcctcgtaataattctacagttgaaatgcaacaatatgcagacgcagtttcagttcaaccgtctaatgatgttgccaagccaattaatgctggtaatgcatcccttaatccagtccaaaatcttctacccaccacaaggatgctgccacctgggaactcccaggccttgcagatgtctcaagggctcttgtcgggaacttccatgccaccgcgtccacaacagctggattcacaatcatcacttcagcagcagcagcaacatcagcaacatcaacatcagcaacaacagcagcagcagcagcagcagcagcagcaccaacaacaacaacaacaacaacaacaacaccaacaacaacaacagcagcaacaaatgcaacaacagcaacctcagcaaagccaacactcctttattcaacaacagcatccccagctccagagatcaatgatgcttgcagctggaaatccactttcacaattgaatgcaattgggcagacgtcgaatgtacagttaggtagcatggtaaataagttcccattgcaatatcaggtgtaccagcagcagcagcagcaacaacaacagcagcagcagcagcaacaacaacaacaaccgcaaatgcagaggaaaataatgatgggagcgactatgggtatggggaccctgggaaataacatggttgggctttctgggcttggcaataccatgggcatgggagctgcaagggggataggaggagctggaatgtcagcacctatgacccctatctctggaatgggaaatgtgggtcagaacccattgaatgcaataaaccagaatgcaataaatcagcaacgatttcaagctctcatggcaaacaaaatgcggatgcaaaaccgaggcagcatgttaggggtccctcaatcaagcatggctggtatgtcaggagccagacagatgcatcctggatctgctgctggtctgtcaatgctgggtcagactctgaaccgaaataacatgatgcaacaagcagcaatggggcctatgggtccaccaacaccaaagttgatggcagggatgaatatttacatgaactcacagcagcaacagcagcagcaacaacagcaacagcagcaaatgcaacagcagttgcaaccgcaatcaatgcaattgcagttgcaacaacagcagcaagtgcagcagcctcagcagcaagatacgaattcaccgctacaggccgttctttcgccaccacaggtgagctccccctcaactatgggaatttcacaaatgaaccagcaaattcagcagcaggctagcccacagcaaatgacccaaagaactccgatgagtccacagctgagctcaggggctattcatgccatgagtgccggtaatccagaggcttgtcctgcaagcccacagctgagctctcaaacgcatggctctgttggtagcatcgcaaattctcctatggaccttcaagctgcaaacaactctaccggtaatgcgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

1345

Amino Acids

146.54

Weight (kDa)

8.97

Isoelectric Point (pI)

59.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 3047
Acc65I GGTACC 2 cut(s) 32, 1082
AccB1I GGYRCC 4 cut(s) 32, 1082, 1397, 1567
AccB7I CCANNNNNTGG 1 cut(s) 2333
AccI GTMKAC 1 cut(s) 706
AccII CGCG 2 cut(s) 896, 2761
AclI AACGTT 1 cut(s) 75
AclWI GGATC 8 cut(s) 477, 490, 629, 1018, 1237, 1545, 1936, 3499
AcoI YGGCCR 1 cut(s) 1935
AcuI CTGAAG 3 cut(s) 156, 204, 2777
AcyI GRCGYC 2 cut(s) 851, 3044
AfaI GTAC 8 cut(s) 34, 398, 1084, 2338, 2351, 2463, 3054, 3101
AflII CTTAAG 1 cut(s) 910
AflIII ACRYGT 1 cut(s) 90
AgeI ACCGGT 1 cut(s) 4025
AhdI GACNNNNNGTC 1 cut(s) 1022
AjiI CACGTC 1 cut(s) 91
AleI CACNNNNGTG 1 cut(s) 415
Alw21I GWGCWC 5 cut(s) 1446, 1796, 3788, 3890, 3956
Alw26I GTCTC 9 cut(s) 25, 62, 200, 600, 1150, 1412, 1686, 2144, 2730
AlwI GGATC 8 cut(s) 477, 490, 629, 1018, 1237, 1545, 1936, 3499
AlwNI CAGNNNCTG 5 cut(s) 209, 1019, 1175, 1802, 3526
ArsI GACNNNNNNTTYG 2 cut(s) 1397, 1429
AseI ATTAAT 1 cut(s) 2634
AsiGI ACCGGT 1 cut(s) 4025
Asp718I GGTACC 2 cut(s) 32, 1082
AspLEI GCGC 1 cut(s) 896
AsuC2I CCSGG 1 cut(s) 1654
AsuHPI GGTGA 4 cut(s) 587, 1128, 3741, 3793
AsuII TTCGAA 1 cut(s) 2153
AsuNHI GCTAGC 1 cut(s) 3839
AvaII GGWCC 9 cut(s) 502, 1003, 1016, 1164, 1727, 3204, 3439, 3572, 4000
AxyI CCTNAGG 1 cut(s) 2292
BaeGI GKGCMC 1 cut(s) 1339
BaeI ACNNNNGTAYC 2 cut(s) 1066, 1099
BamHI GGATCC 1 cut(s) 482
BanI GGYRCC 4 cut(s) 32, 1082, 1397, 1567
BanII GRGCYC 7 cut(s) 1446, 1796, 2192, 2736, 3788, 3890, 3956
Bbv12I GWGCWC 5 cut(s) 1446, 1796, 3788, 3890, 3956
BbvCI CCTCAGC 4 cut(s) 1168, 1909, 2937, 3729
BceAI ACGGC 2 cut(s) 1348, 3746
BcgI CGANNNNNNTGC 4 cut(s) 86, 120, 286, 320
BciVI GTATCC 1 cut(s) 1292
BclI TGATCA 2 cut(s) 876, 2310
BcnI CCSGG 1 cut(s) 1654
BcoDI GTCTC 9 cut(s) 25, 62, 200, 600, 1150, 1412, 1686, 2144, 2730
BfaI CTAG 4 cut(s) 632, 2097, 2381, 3840
BfmI CTRYAG 7 cut(s) 201, 1212, 1371, 1722, 2340, 2565, 3755
BfrI CTTAAG 1 cut(s) 910
BfuI GTATCC 1 cut(s) 1292
BglI GCCNNNNNGGC 1 cut(s) 1763
BglII AGATCT 1 cut(s) 914
BlpI GCTNAGC 2 cut(s) 3884, 3950
Bme18I GGWCC 9 cut(s) 502, 1003, 1016, 1164, 1727, 3204, 3439, 3572, 4000
BmeRI GACNNNNNGTC 1 cut(s) 1022
BmgBI CACGTC 1 cut(s) 91
BmtI GCTAGC 1 cut(s) 3843
BoxI GACNNNNGTC 1 cut(s) 1162
BpmI CTGGAG 3 cut(s) 113, 387, 2966
Bpu10I CCTNAGC 5 cut(s) 1168, 1909, 2937, 3729, 3889
Bpu1102I GCTNAGC 2 cut(s) 3884, 3950
Bpu14I TTCGAA 1 cut(s) 2153
BpuEI CTTGAG 1 cut(s) 2712
BpuMI CCSGG 1 cut(s) 1654
BsaBI GATNNNNATC 1 cut(s) 1061
BsaHI GRCGYC 2 cut(s) 851, 3044
BsaI GGTCTC 3 cut(s) 25, 62, 1150
BsaWI WCCGGW 1 cut(s) 4025
BsaXI ACNNNNNCTCC 4 cut(s) 559, 589, 1610, 1640
Bse118I RCCGGY 2 cut(s) 3914, 4025
Bse21I CCTNAGG 1 cut(s) 2292
Bse3DI GCAATG 6 cut(s) 1194, 1794, 1920, 2352, 3083, 3564
Bse8I GATNNNNATC 1 cut(s) 1061
BseJI GATNNNNATC 1 cut(s) 1061
BseMI GCAATG 6 cut(s) 1194, 1794, 1920, 2352, 3083, 3564
BseRI GAGGAG 3 cut(s) 45, 100, 3294
BseSI GKGCMC 1 cut(s) 1339
BseYI CCCAGC 3 cut(s) 1664, 2976, 3514
BsgI GTGCAG 2 cut(s) 290, 3740
Bsh1236I CGCG 2 cut(s) 896, 2761
BshNI GGYRCC 4 cut(s) 32, 1082, 1397, 1567
BshTI ACCGGT 1 cut(s) 4025
BsiHKAI GWGCWC 5 cut(s) 1446, 1796, 3788, 3890, 3956
BsiSI CCGG 4 cut(s) 1654, 1934, 3915, 4026
BslFI GGGAC 7 cut(s) 30, 997, 1369, 1635, 1962, 3217, 3425
BsmAI GTCTC 9 cut(s) 25, 62, 200, 600, 1150, 1412, 1686, 2144, 2730
BsmFI GGGAC 7 cut(s) 30, 997, 1369, 1635, 1962, 3217, 3425
BsmI GAATGC 5 cut(s) 283, 1537, 3034, 3352, 3367
Bso31I GGTCTC 3 cut(s) 25, 62, 1150
Bsp119I TTCGAA 1 cut(s) 2153
Bsp1286I GDGCHC 8 cut(s) 1339, 1446, 1796, 2192, 2736, 3788, 3890, 3956
Bsp1407I TGTACA 1 cut(s) 3052
Bsp1720I GCTNAGC 2 cut(s) 3884, 3950
Bsp19I CCATGG 3 cut(s) 1006, 2353, 3249
BspFNI CGCG 2 cut(s) 896, 2761
BspHI TCATGA 1 cut(s) 1545
BspMAI CTGCAG 1 cut(s) 205
BspOI GCTAGC 1 cut(s) 3843
BspPI GGATC 8 cut(s) 477, 490, 629, 1018, 1237, 1545, 1936, 3499
BspT104I TTCGAA 1 cut(s) 2153
BspT107I GGYRCC 4 cut(s) 32, 1082, 1397, 1567
BspTI CTTAAG 1 cut(s) 910
BspTNI GGTCTC 3 cut(s) 25, 62, 1150
BsrDI GCAATG 6 cut(s) 1194, 1794, 1920, 2352, 3083, 3564
BsrFI RCCGGY 2 cut(s) 3914, 4025
BsrGI TGTACA 1 cut(s) 3052
BssAI RCCGGY 2 cut(s) 3914, 4025
BssNAI GTATAC 1 cut(s) 707
BssNI GRCGYC 2 cut(s) 851, 3044
BssT1I CCWWGG 6 cut(s) 859, 1006, 1401, 1582, 2353, 3249
Bst1107I GTATAC 1 cut(s) 707
Bst6I CTCTTC 2 cut(s) 239, 341
BstACI GRCGYC 2 cut(s) 851, 3044
BstAFI CTTAAG 1 cut(s) 910
BstAPI GCANNNNNTGC 4 cut(s) 2920, 3661, 3688, 3718
BstAUI TGTACA 1 cut(s) 3052
BstBI TTCGAA 1 cut(s) 2153
BstC8I GCNNGC 8 cut(s) 841, 1177, 2015, 2436, 3000, 3837, 3841, 3940
BstDSI CCRYGG 3 cut(s) 1006, 2353, 3249
BstFNI CGCG 2 cut(s) 896, 2761
BstHHI GCGC 1 cut(s) 896
BstMAI GTCTC 9 cut(s) 25, 62, 200, 600, 1150, 1412, 1686, 2144, 2730
BstNSI RCATGY 3 cut(s) 2017, 2518, 3433
BstPAI GACNNNNGTC 1 cut(s) 1162
BstSFI CTRYAG 7 cut(s) 201, 1212, 1371, 1722, 2340, 2565, 3755
BstSLI GKGCMC 1 cut(s) 1339
BstUI CGCG 2 cut(s) 896, 2761
BstX2I RGATCY 6 cut(s) 482, 634, 914, 1550, 1928, 3491
BstXI CCANNNNNNTGG 1 cut(s) 3256
BstYI RGATCY 6 cut(s) 482, 634, 914, 1550, 1928, 3491
BstZ17I GTATAC 1 cut(s) 707
Bsu36I CCTNAGG 1 cut(s) 2292
BsuI GTATCC 1 cut(s) 1292
BtgI CCRYGG 3 cut(s) 1006, 2353, 3249
BtgZI GCGATG 2 cut(s) 889, 3967
BtrI CACGTC 1 cut(s) 91
BtsIMutI CAGTG 7 cut(s) 518, 1337, 1453, 1647, 1837, 1945, 2453
Cac8I GCNNGC 8 cut(s) 841, 1177, 2015, 2436, 3000, 3837, 3841, 3940
CaiI CAGNNNCTG 5 cut(s) 209, 1019, 1175, 1802, 3526
CciI TCATGA 1 cut(s) 1545
CfoI GCGC 1 cut(s) 896
Cfr10I RCCGGY 2 cut(s) 3914, 4025
CseI GACGC 3 cut(s) 859, 2600, 2750
CsiI ACCWGGT 1 cut(s) 35
Csp6I GTAC 8 cut(s) 33, 397, 1083, 2337, 2350, 2462, 3053, 3100
CspAI ACCGGT 1 cut(s) 4025
CspCI CAANNNNNGTGG 2 cut(s) 667, 702
CviQI GTAC 8 cut(s) 33, 397, 1083, 2337, 2350, 2462, 3053, 3100
DraI TTTAAA 2 cut(s) 2170, 2247
DriI GACNNNNNGTC 1 cut(s) 1022
EaeI YGGCCR 1 cut(s) 1935
Eam1104I CTCTTC 2 cut(s) 239, 341
Eam1105I GACNNNNNGTC 1 cut(s) 1022
EarI CTCTTC 2 cut(s) 239, 341
EciI GGCGGA 2 cut(s) 459, 494
Ecl136II GAGCTC 5 cut(s) 1444, 1794, 3786, 3888, 3954
Eco130I CCWWGG 6 cut(s) 859, 1006, 1401, 1582, 2353, 3249
Eco147I AGGCCT 1 cut(s) 2714
Eco24I GRGCYC 7 cut(s) 1446, 1796, 2192, 2736, 3788, 3890, 3956
Eco31I GGTCTC 3 cut(s) 25, 62, 1150
Eco32I GATATC 1 cut(s) 541
Eco47I GGWCC 9 cut(s) 502, 1003, 1016, 1164, 1727, 3204, 3439, 3572, 4000
Eco53kI GAGCTC 5 cut(s) 1444, 1794, 3786, 3888, 3954
Eco57I CTGAAG 3 cut(s) 156, 204, 2777
Eco81I CCTNAGG 1 cut(s) 2292
EcoICRI GAGCTC 5 cut(s) 1444, 1794, 3786, 3888, 3954
EcoO109I RGGNCCY 7 cut(s) 1016, 1164, 1208, 1727, 3204, 3439, 3563
EcoRI GAATTC 1 cut(s) 3745
EcoRV GATATC 1 cut(s) 541
EcoT14I CCWWGG 6 cut(s) 859, 1006, 1401, 1582, 2353, 3249
EcoT22I ATGCAT 2 cut(s) 2650, 3486
EcoT38I GRGCYC 7 cut(s) 1446, 1796, 2192, 2736, 3788, 3890, 3956
ErhI CCWWGG 6 cut(s) 859, 1006, 1401, 1582, 2353, 3249
FaqI GGGAC 7 cut(s) 30, 997, 1369, 1635, 1962, 3217, 3425
FauI CCCGC 2 cut(s) 1509, 2519
FauNDI CATATG 1 cut(s) 313
FbaI TGATCA 2 cut(s) 876, 2310
FblI GTMKAC 1 cut(s) 706
FriOI GRGCYC 7 cut(s) 1446, 1796, 2192, 2736, 3788, 3890, 3956
FspBI CTAG 4 cut(s) 632, 2097, 2381, 3840
GlaI GCGC 1 cut(s) 895
GsaI CCCAGC 3 cut(s) 1668, 2980, 3518
GsuI CTGGAG 3 cut(s) 113, 387, 2966
HapII CCGG 4 cut(s) 1654, 1934, 3915, 4026
HgaI GACGC 3 cut(s) 859, 2600, 2750
HhaI GCGC 1 cut(s) 896
Hin1I GRCGYC 2 cut(s) 851, 3044
Hin6I GCGC 1 cut(s) 894
HinP1I GCGC 1 cut(s) 894
HindIII AAGCTT 2 cut(s) 609, 683
HpaII CCGG 4 cut(s) 1654, 1934, 3915, 4026
HphI GGTGA 4 cut(s) 587, 1128, 3741, 3793
Hpy166II GTNNAC 7 cut(s) 707, 1049, 2453, 2765, 3100, 3575, 3878
Hpy8I GTNNAC 7 cut(s) 707, 1049, 2453, 2765, 3100, 3575, 3878
Hpy99I CGWCG 1 cut(s) 3049
HpyAV CCTTC 7 cut(s) 229, 529, 1325, 1427, 1472, 1768, 4013
HpyCH4IV ACGT 5 cut(s) 75, 90, 224, 2405, 3044
HpySE526I ACGT 5 cut(s) 75, 90, 224, 2405, 3044
Hsp92I GRCGYC 2 cut(s) 851, 3044
HspAI GCGC 1 cut(s) 894
KflI GGGWCCC 2 cut(s) 3204, 3439
KpnI GGTACC 2 cut(s) 36, 1086
Ksp22I TGATCA 2 cut(s) 876, 2310
LmnI GCTCC 9 cut(s) 132, 1745, 2257, 2985, 3185, 3260, 3281, 3470, 3791
MabI ACCWGGT 1 cut(s) 35
MaeI CTAG 4 cut(s) 632, 2097, 2381, 3840
MaeII ACGT 5 cut(s) 75, 90, 224, 2405, 3044
MaeIII GTNAC 6 cut(s) 516, 739, 745, 1134, 1798, 2044
MfeI CAATTG 5 cut(s) 252, 345, 3023, 3033, 3692
MflI RGATCY 6 cut(s) 482, 634, 914, 1550, 1928, 3491
MhlI GDGCHC 8 cut(s) 1339, 1446, 1796, 2192, 2736, 3788, 3890, 3956
MlyI GAGTC 6 cut(s) 185, 602, 979, 1749, 3517, 3883
MmeI TCCRAC 6 cut(s) 630, 695, 1723, 1906, 1966, 2521
Mph1103I ATGCAT 2 cut(s) 2650, 3486
MseI TTAA 9 cut(s) 15, 227, 911, 1455, 1964, 2169, 2246, 2634, 2655
MslI CAYNNNNRTG 6 cut(s) 288, 312, 415, 1122, 2687, 3254
MspA1I CMGCKG 6 cut(s) 1175, 1703, 2773, 3005, 3883, 3949
MspCI CTTAAG 1 cut(s) 910
MspI CCGG 4 cut(s) 1654, 1934, 3915, 4026
MunI CAATTG 5 cut(s) 252, 345, 3023, 3033, 3692
Mva1269I GAATGC 5 cut(s) 283, 1537, 3034, 3352, 3367
MvnI CGCG 2 cut(s) 896, 2761
NciI CCSGG 1 cut(s) 1654
NcoI CCATGG 3 cut(s) 1006, 2353, 3249
NdeI CATATG 1 cut(s) 313
NheI GCTAGC 1 cut(s) 3839
NmeAIII GCCGAG 1 cut(s) 320
NmuCI GTSAC 3 cut(s) 516, 1134, 2044
NsiI ATGCAT 2 cut(s) 2650, 3486
NspI RCATGY 3 cut(s) 2017, 2518, 3433
NspV TTCGAA 1 cut(s) 2153
OliI CACNNNNGTG 1 cut(s) 415
PaeI GCATGC 1 cut(s) 2017
PagI TCATGA 1 cut(s) 1545
PasI CCCWGGG 1 cut(s) 3208
PceI AGGCCT 1 cut(s) 2714
PcsI WCGNNNNNNNCGW 2 cut(s) 81, 433
PctI GAATGC 5 cut(s) 283, 1537, 3034, 3352, 3367
PfeI GAWTC 9 cut(s) 350, 667, 824, 831, 1249, 1342, 1841, 2177, 2777
PflMI CCANNNNNTGG 1 cut(s) 2333
PfoI TCCNGGA 2 cut(s) 1102, 3487
PinAI ACCGGT 1 cut(s) 4025
PleI GAGTC 6 cut(s) 184, 601, 979, 1748, 3517, 3882
PpsI GAGTC 6 cut(s) 184, 601, 979, 1748, 3517, 3882
PpuMI RGGWCCY 5 cut(s) 1016, 1164, 1727, 3204, 3439
PshAI GACNNNNGTC 1 cut(s) 1162
PshBI ATTAAT 1 cut(s) 2634
Psp124BI GAGCTC 5 cut(s) 1446, 1796, 3788, 3890, 3956
Psp1406I AACGTT 1 cut(s) 75
Psp5II RGGWCCY 5 cut(s) 1016, 1164, 1727, 3204, 3439
PspFI CCCAGC 3 cut(s) 1664, 2976, 3514
PspPPI RGGWCCY 5 cut(s) 1016, 1164, 1727, 3204, 3439
PsrI GAACNNNNNNTAC 2 cut(s) 151, 183
PstI CTGCAG 1 cut(s) 205
PstNI CAGNNNCTG 5 cut(s) 209, 1019, 1175, 1802, 3526
PsuI RGATCY 6 cut(s) 482, 634, 914, 1550, 1928, 3491
PvuII CAGCTG 5 cut(s) 1175, 2773, 3005, 3883, 3949
RsaI GTAC 8 cut(s) 34, 398, 1084, 2338, 2351, 2463, 3054, 3101
RsaNI GTAC 8 cut(s) 33, 397, 1083, 2337, 2350, 2462, 3053, 3100
RseI CAYNNNNRTG 6 cut(s) 288, 312, 415, 1122, 2687, 3254
SacI GAGCTC 5 cut(s) 1446, 1796, 3788, 3890, 3956
SaqAI TTAA 9 cut(s) 15, 227, 911, 1455, 1964, 2169, 2246, 2634, 2655
SchI GAGTC 6 cut(s) 185, 602, 979, 1749, 3517, 3883
SduI GDGCHC 8 cut(s) 1339, 1446, 1796, 2192, 2736, 3788, 3890, 3956
SexAI ACCWGGT 1 cut(s) 35
SfcI CTRYAG 7 cut(s) 201, 1212, 1371, 1722, 2340, 2565, 3755
SfuI TTCGAA 1 cut(s) 2153
SinI GGWCC 9 cut(s) 502, 1003, 1016, 1164, 1727, 3204, 3439, 3572, 4000
SmiMI CAYNNNNRTG 6 cut(s) 288, 312, 415, 1122, 2687, 3254
SmlI CTYRAG 2 cut(s) 910, 2727
SmoI CTYRAG 2 cut(s) 910, 2727
SphI GCATGC 1 cut(s) 2017
SseBI AGGCCT 1 cut(s) 2714
SspI AATATT 2 cut(s) 1594, 3607
SspMI CTAG 4 cut(s) 632, 2097, 2381, 3840
SstI GAGCTC 5 cut(s) 1446, 1796, 3788, 3890, 3956
StuI AGGCCT 1 cut(s) 2714
StyI CCWWGG 6 cut(s) 859, 1006, 1401, 1582, 2353, 3249
TaiI ACGT 5 cut(s) 78, 93, 227, 2408, 3047
TaqI TCGA 5 cut(s) 427, 1889, 2153, 2198, 3047
TaqII GACCGA 1 cut(s) 1174
TatI WGTACW 2 cut(s) 396, 3052
TauI GCSGC 1 cut(s) 464
TfiI GAWTC 9 cut(s) 350, 667, 824, 831, 1249, 1342, 1841, 2177, 2777
Tru1I TTAA 9 cut(s) 15, 227, 911, 1455, 1964, 2169, 2246, 2634, 2655
Tru9I TTAA 9 cut(s) 15, 227, 911, 1455, 1964, 2169, 2246, 2634, 2655
TscAI CASTG 7 cut(s) 525, 1344, 1453, 1647, 1837, 1945, 2460
TseFI GTSAC 3 cut(s) 516, 1134, 2044
Tsp45I GTSAC 3 cut(s) 516, 1134, 2044
TspGWI ACGGA 5 cut(s) 32, 495, 724, 1897, 2082
TspRI CASTG 7 cut(s) 525, 1344, 1453, 1647, 1837, 1945, 2460
Van91I CCANNNNNTGG 1 cut(s) 2333
Vha464I CTTAAG 1 cut(s) 910
VpaK11BI GGWCC 9 cut(s) 502, 1003, 1016, 1164, 1727, 3204, 3439, 3572, 4000
VspI ATTAAT 1 cut(s) 2634
XbaI TCTAGA 1 cut(s) 631
XceI RCATGY 3 cut(s) 2017, 2518, 3433
XcmI CCANNNNNNNNNTGG 2 cut(s) 646, 2419
XmiI GTMKAC 1 cut(s) 706
XspI CTAG 4 cut(s) 632, 2097, 2381, 3840
ZraI GACGTC 1 cut(s) 3045
Zsp2I ATGCAT 2 cut(s) 2650, 3486
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.