Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002070.1

Orthogroup ID

OG0010927

Physical Location & Seq

Genomic Coordinates Forward (+)

3320 .. 4280

Gene Structure 961 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002070.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 504 bp

atggtggaagatggttgcgctgagaatgcaatttctttgctgatcttggccagtagcattctaggcaaggttctcaagtactgcaagaagcacatagatgacaaggaggcaaactatcttagcaatgctgggctgctggatttgacatgtcagactgtggcgaacatgatcaagggaatgattcctagagagattcacaagaaattattcagtttgacaattaagcaaatggtggaagatggttgcgccgagaatgcaatttctttgctgatcttggacagtagcattctaggcaagggtctcaagtactgcaagaagcacatagatgacaaggaggcacactatcttagcaatgctgggctgctggatttgacatgtcagactgtggcgaacatgatcaagggaatgattcctagagagattcacaagactttcaacatcaagaatgacttcactcctgagggaagaagaggttccgaaggagaaccaataggttttctgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04110 ko04111 ko04114 ko04120 ko04141 ko04310 ko04341 ko04350 ko04710 ko05168 ko05200 map04110 map04111 map04114 map04120 map04141 map04310 map04341 map04350 map04710 map05168 map05200

Pfam Domains

Protein Families

Skp1 Skp1_POZ

Protein Analysis

167

Amino Acids

18.42

Weight (kDa)

6.94

Isoelectric Point (pI)

34.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010927)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G52620
fragaria_vesca	FvH4_6g30030
malus_domestica	MD17G1208200.v1.1
prunus_persica	Prupe.3G082900_v2.0.a1
pyrus_communis	pycom17g21100
rosa_chinensis	RchiOBHm_Chr2g0136061 RchiOBHm_Chr2g0136071
rosa_laevigata	RLG00000019500
rosa_multiflora	Rmu_sc0002070.1_g000001 Rmu_sc0002070.1_g000002 Rmu_sc0002986.1_g000008 Rmu_sc0002986.1_g000009
rosa_roxburghii	Rroxscaffold_2G00108610
rosa_rugosa	Rorug02G0327800
rosa_samantha	Rh2AG379700 Rh2BG386200 Rh2CG365600 Rh2CG365700 Rh2DG402500
rosa_wichuraiana	Rw2G030950

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	48
AfaI	GTAC	2 cut(s)	80, 308
AflIII	ACRYGT	2 cut(s)	146, 374
AgsI	TTSAA	1 cut(s)	436
Alw26I	GTCTC	1 cut(s)	305
AoxI	GGCC	1 cut(s)	48
ApeKI	GCWGC	2 cut(s)	133, 361
Asp700I	GAANNNNTTC	3 cut(s)	206, 449, 472
AspLEI	GCGC	2 cut(s)	20, 248
AxyI	CCTNAGG	1 cut(s)	459
BalI	TGGCCA	1 cut(s)	50
BbvI	GCAGC	2 cut(s)	120, 348
BccI	CCATC	2 cut(s)	5, 233
BclI	TGATCA	2 cut(s)	168, 396
BcoDI	GTCTC	1 cut(s)	305
BfaI	CTAG	4 cut(s)	62, 186, 290, 414
BfmI	CTRYAG	1 cut(s)	500
BisI	GCNGC	2 cut(s)	134, 362
BlsI	GCNGC	2 cut(s)	135, 363
BmcAI	AGTACT	2 cut(s)	80, 308
BmiI	GGNNCC	1 cut(s)	475
BpuEI	CTTGAG	2 cut(s)	59, 287
BsaI	GGTCTC	1 cut(s)	305
Bse1I	ACTGG	1 cut(s)	51
Bse21I	CCTNAGG	1 cut(s)	459
Bse3DI	GCAATG	2 cut(s)	130, 358
BseMI	GCAATG	2 cut(s)	130, 358
BseMII	CTCAG	2 cut(s)	12, 450
BseNI	ACTGG	1 cut(s)	51
BseXI	GCAGC	2 cut(s)	120, 348
BseYI	CCCAGC	2 cut(s)	128, 356
BshFI	GGCC	1 cut(s)	50
BsmAI	GTCTC	1 cut(s)	305
BsmI	GAATGC	4 cut(s)	31, 57, 259, 285
BsnI	GGCC	1 cut(s)	50
Bso31I	GGTCTC	1 cut(s)	305
Bsp143I	GATC	4 cut(s)	42, 168, 270, 396
BspANI	GGCC	1 cut(s)	50
BspCNI	CTCAG	2 cut(s)	13, 451
BspLI	GGNNCC	1 cut(s)	475
BspTNI	GGTCTC	1 cut(s)	305
BsrDI	GCAATG	2 cut(s)	130, 358
BsrI	ACTGG	1 cut(s)	51
BssMI	GATC	4 cut(s)	42, 168, 270, 396
Bst4CI	ACNGT	3 cut(s)	157, 281, 385
Bst6I	CTCTTC	1 cut(s)	463
BstDEI	CTNAG	4 cut(s)	21, 119, 347, 459
BstHHI	GCGC	2 cut(s)	20, 248
BstKTI	GATC	4 cut(s)	45, 171, 273, 399
BstMAI	GTCTC	1 cut(s)	305
BstMBI	GATC	4 cut(s)	42, 168, 270, 396
BstMWI	GCNNNNNNNGC	4 cut(s)	26, 63, 254, 291
BstNSI	RCATGY	2 cut(s)	150, 378
BstSFI	CTRYAG	1 cut(s)	500
BstV1I	GCAGC	2 cut(s)	120, 348
Bsu36I	CCTNAGG	1 cut(s)	459
BsuRI	GGCC	1 cut(s)	50
CfoI	GCGC	2 cut(s)	20, 248
Csp6I	GTAC	2 cut(s)	79, 307
CviAII	CATG	4 cut(s)	147, 166, 375, 394
CviJI	RGCY	3 cut(s)	50, 133, 361
CviKI_1	RGCY	3 cut(s)	50, 133, 361
CviQI	GTAC	2 cut(s)	79, 307
DdeI	CTNAG	4 cut(s)	21, 119, 347, 459
DpnI	GATC	4 cut(s)	44, 170, 272, 398
DpnII	GATC	4 cut(s)	42, 168, 270, 396
EaeI	YGGCCR	1 cut(s)	48
Eam1104I	CTCTTC	1 cut(s)	463
EarI	CTCTTC	1 cut(s)	463
Eco31I	GGTCTC	1 cut(s)	305
Eco81I	CCTNAGG	1 cut(s)	459
FaeI	CATG	4 cut(s)	150, 169, 378, 397
FaiI	YATR	6 cut(s)	95, 148, 167, 323, 376, 395
FalI	AAGNNNNNCTT	2 cut(s)	434, 466
FatI	CATG	4 cut(s)	146, 165, 374, 393
FbaI	TGATCA	2 cut(s)	168, 396
Fnu4HI	GCNGC	2 cut(s)	134, 362
Fsp4HI	GCNGC	2 cut(s)	134, 362
FspBI	CTAG	4 cut(s)	62, 186, 290, 414
GlaI	GCGC	2 cut(s)	19, 247
GluI	GCNGC	2 cut(s)	134, 362
GsaI	CCCAGC	2 cut(s)	132, 360
HaeIII	GGCC	1 cut(s)	50
HhaI	GCGC	2 cut(s)	20, 248
Hin1II	CATG	4 cut(s)	150, 169, 378, 397
Hin6I	GCGC	2 cut(s)	18, 246
HinP1I	GCGC	2 cut(s)	18, 246
HinfI	GANTC	4 cut(s)	181, 193, 409, 421
Hpy188I	TCNGA	3 cut(s)	153, 381, 478
Hpy188III	TCNNGA	2 cut(s)	442, 458
HpyAV	CCTTC	1 cut(s)	473
HpyCH4III	ACNGT	3 cut(s)	157, 281, 385
HpyCH4V	TGCA	4 cut(s)	29, 84, 257, 312
HpyF10VI	GCNNNNNNNGC	4 cut(s)	26, 63, 254, 291
HpyF3I	CTNAG	4 cut(s)	21, 119, 347, 459
Hsp92II	CATG	4 cut(s)	150, 169, 378, 397
HspAI	GCGC	2 cut(s)	18, 246
Ksp22I	TGATCA	2 cut(s)	168, 396
Kzo9I	GATC	4 cut(s)	42, 168, 270, 396
LpnPI	CCDG	6 cut(s)	64, 114, 122, 342, 350, 471
Lsp1109I	GCAGC	2 cut(s)	120, 348
MaeI	CTAG	4 cut(s)	62, 186, 290, 414
MalI	GATC	4 cut(s)	44, 170, 272, 398
MboI	GATC	4 cut(s)	42, 168, 270, 396
MboII	GAAGA	4 cut(s)	20, 248, 477, 480
MlsI	TGGCCA	1 cut(s)	50
MluCI	AATT	4 cut(s)	30, 203, 219, 258
MluNI	TGGCCA	1 cut(s)	50
MnlI	CCTC	4 cut(s)	100, 328, 454, 464
Mox20I	TGGCCA	1 cut(s)	50
MroXI	GAANNNNTTC	3 cut(s)	206, 449, 472
MscI	TGGCCA	1 cut(s)	50
MseI	TTAA	1 cut(s)	222
MslI	CAYNNNNRTG	2 cut(s)	96, 324
Msp20I	TGGCCA	1 cut(s)	50
Mva1269I	GAATGC	4 cut(s)	31, 57, 259, 285
MwoI	GCNNNNNNNGC	4 cut(s)	26, 63, 254, 291
NdeII	GATC	4 cut(s)	42, 168, 270, 396
NlaIII	CATG	4 cut(s)	150, 169, 378, 397
NlaIV	GGNNCC	1 cut(s)	475
NmeAIII	GCCGAG	1 cut(s)	274
NspI	RCATGY	2 cut(s)	150, 378
PciI	ACATGT	2 cut(s)	146, 374
PctI	GAATGC	4 cut(s)	31, 57, 259, 285
PdmI	GAANNNNTTC	3 cut(s)	206, 449, 472
PfeI	GAWTC	4 cut(s)	181, 193, 409, 421
PkrI	GCNGC	2 cut(s)	135, 363
PscI	ACATGT	2 cut(s)	146, 374
PspFI	CCCAGC	2 cut(s)	128, 356
PspN4I	GGNNCC	1 cut(s)	475
RsaI	GTAC	2 cut(s)	80, 308
RsaNI	GTAC	2 cut(s)	79, 307
RseI	CAYNNNNRTG	2 cut(s)	96, 324
SaqAI	TTAA	1 cut(s)	222
SatI	GCNGC	2 cut(s)	134, 362
Sau3AI	GATC	4 cut(s)	42, 168, 270, 396
ScaI	AGTACT	2 cut(s)	80, 308
SetI	ASST	3 cut(s)	72, 475, 496
SfcI	CTRYAG	1 cut(s)	500
SmiMI	CAYNNNNRTG	2 cut(s)	96, 324
SmlI	CTYRAG	2 cut(s)	74, 302
SmoI	CTYRAG	2 cut(s)	74, 302
Sse9I	AATT	4 cut(s)	30, 203, 219, 258
SspMI	CTAG	4 cut(s)	62, 186, 290, 414
TaaI	ACNGT	3 cut(s)	157, 281, 385
TasI	AATT	4 cut(s)	30, 203, 219, 258
TatI	WGTACW	2 cut(s)	78, 306
TfiI	GAWTC	4 cut(s)	181, 193, 409, 421
Tru1I	TTAA	1 cut(s)	222
Tru9I	TTAA	1 cut(s)	222
TseI	GCWGC	2 cut(s)	133, 361
XceI	RCATGY	2 cut(s)	150, 378
XmnI	GAANNNNTTC	3 cut(s)	206, 449, 472
XspI	CTAG	4 cut(s)	62, 186, 290, 414
ZrmI	AGTACT	2 cut(s)	80, 308

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.