Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002073.1

Orthogroup ID

OG0007499

Physical Location & Seq

Genomic Coordinates Forward (+)

88959 .. 89429

Gene Structure 471 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002073.1_g000022.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

atgcttgcgatcgccatccatcatattatcataggtatagattcagcttggttccttgataatgagggaaaggtcccatgccatcagcagatagttttggacctgcaacgtgatggaaaagtgaccacatctgataatcctcccgttgtatttggtttcttaggtttggacttgatacagaagttgggaacattgcagtcaggatgtcttcttcgttttgctattggtgatgggggattgaccattatggatgggaagcttgagaaggcggacttacattaccttggcaagttcaactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03013 map03013

Pfam Domains

Protein Families

No domains found.

Protein Analysis

99

Amino Acids

10.8

Weight (kDa)

5.66

Isoelectric Point (pI)

37.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007499)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g11820
rosa_chinensis	RchiOBHm_Chr4g0407901 RchiOBHm_Chr4g0407951 RchiOBHm_Chr4g0409241
rosa_laevigata	RLG00000008584 RLG00000008680
rosa_multiflora	Rmu_co8062950.1_g000001 Rmu_co8330257.1_g000001 Rmu_sc0002073.1_g000022 Rmu_sc0002377.1_g000017
rosa_roxburghii	Rroxscaffold_5G00352510
rosa_rugosa	Rorug04G0082800 Rorug04G0082900 Rorug04G0091400
rosa_samantha	Rh4AG147600 Rh4AG154700 Rh4BG144900 Rh4BG152400 Rh4CG154100 Rh4CG163800 Rh4DG147500 Rh7AG365900 Rh7CG384500
rosa_wichuraiana	Rw0G019660 Rw4G012630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	111
AciI	CCGC	1 cut(s)	269
AgsI	TTSAA	1 cut(s)	295
AluBI	AGCT	2 cut(s)	47, 259
AluI	AGCT	2 cut(s)	47, 259
AsiSI	GCGATCGC	1 cut(s)	12
AspS9I	GGNCC	2 cut(s)	73, 100
AsuHPI	GGTGA	1 cut(s)	239
AvaII	GGWCC	2 cut(s)	73, 100
BaeI	ACNNNNGTAYC	2 cut(s)	167, 200
BbsI	GAAGAC	1 cut(s)	200
BccI	CCATC	6 cut(s)	23, 27, 90, 107, 224, 245
BfaI	CTAG	1 cut(s)	298
BfuAI	ACCTGC	1 cut(s)	111
Bme18I	GGWCC	2 cut(s)	73, 100
BmgT120I	GGNCC	2 cut(s)	73, 100
BmiI	GGNNCC	2 cut(s)	53, 75
BpiI	GAAGAC	1 cut(s)	200
BpuEI	CTTGAG	1 cut(s)	281
BsaBI	GATNNNNATC	1 cut(s)	14
BsaJI	CCNNGG	1 cut(s)	283
Bse3DI	GCAATG	1 cut(s)	191
Bse8I	GATNNNNATC	1 cut(s)	14
BseDI	CCNNGG	1 cut(s)	283
BseGI	GGATG	3 cut(s)	15, 209, 256
BseJI	GATNNNNATC	1 cut(s)	14
BseMI	GCAATG	1 cut(s)	191
Bsh1285I	CGRYCG	1 cut(s)	12
BsiEI	CGRYCG	1 cut(s)	12
BslFI	GGGAC	1 cut(s)	59
BsmFI	GGGAC	1 cut(s)	59
Bsp143I	GATC	1 cut(s)	9
BspACI	CCGC	1 cut(s)	269
BspLI	GGNNCC	2 cut(s)	53, 75
BspMI	ACCTGC	1 cut(s)	111
BsrDI	GCAATG	1 cut(s)	191
BssECI	CCNNGG	1 cut(s)	283
BssMI	GATC	1 cut(s)	9
BssT1I	CCWWGG	1 cut(s)	283
BstC8I	GCNNGC	1 cut(s)	6
BstDEI	CTNAG	1 cut(s)	160
BstF5I	GGATG	3 cut(s)	15, 209, 256
BstKTI	GATC	1 cut(s)	12
BstMBI	GATC	1 cut(s)	9
BstMCI	CGRYCG	1 cut(s)	12
BstV2I	GAAGAC	1 cut(s)	200
BtsCI	GGATG	3 cut(s)	15, 209, 256
BveI	ACCTGC	1 cut(s)	111
Cac8I	GCNNGC	1 cut(s)	6
Cfr13I	GGNCC	2 cut(s)	73, 100
CviAII	CATG	1 cut(s)	78
CviJI	RGCY	2 cut(s)	47, 259
CviKI_1	RGCY	2 cut(s)	47, 259
DdeI	CTNAG	1 cut(s)	160
DpnI	GATC	1 cut(s)	11
DpnII	GATC	1 cut(s)	9
EciI	GGCGGA	1 cut(s)	284
Eco130I	CCWWGG	1 cut(s)	283
Eco47I	GGWCC	2 cut(s)	73, 100
EcoO109I	RGGNCCY	1 cut(s)	73
EcoT14I	CCWWGG	1 cut(s)	283
ErhI	CCWWGG	1 cut(s)	283
FaeI	CATG	1 cut(s)	81
FaiI	YATR	5 cut(s)	24, 32, 38, 79, 248
FalI	AAGNNNNNCTT	2 cut(s)	257, 289
FaqI	GGGAC	1 cut(s)	59
FatI	CATG	1 cut(s)	77
FokI	GGATG	3 cut(s)	2, 216, 263
FspBI	CTAG	1 cut(s)	298
Hin1II	CATG	1 cut(s)	81
HindIII	AAGCTT	1 cut(s)	257
HinfI	GANTC	1 cut(s)	41
HphI	GGTGA	1 cut(s)	239
Hpy188I	TCNGA	1 cut(s)	133
Hpy188III	TCNNGA	1 cut(s)	201
HpyAV	CCTTC	1 cut(s)	259
HpyCH4IV	ACGT	1 cut(s)	109
HpyCH4V	TGCA	2 cut(s)	106, 196
HpyF3I	CTNAG	1 cut(s)	160
HpySE526I	ACGT	1 cut(s)	109
Hsp92II	CATG	1 cut(s)	81
Kzo9I	GATC	1 cut(s)	9
LpnPI	CCDG	2 cut(s)	116, 186
MaeI	CTAG	1 cut(s)	298
MaeII	ACGT	1 cut(s)	109
MaeIII	GTNAC	1 cut(s)	121
MalI	GATC	1 cut(s)	11
MboI	GATC	1 cut(s)	9
MboII	GAAGA	2 cut(s)	200, 203
MnlI	CCTC	2 cut(s)	58, 150
NdeII	GATC	1 cut(s)	9
NlaIII	CATG	1 cut(s)	81
NlaIV	GGNNCC	2 cut(s)	53, 75
NmuCI	GTSAC	1 cut(s)	121
PfeI	GAWTC	1 cut(s)	41
Ple19I	CGATCG	1 cut(s)	12
PpuMI	RGGWCCY	1 cut(s)	73
Psp5II	RGGWCCY	1 cut(s)	73
PspN4I	GGNNCC	2 cut(s)	53, 75
PspPI	GGNCC	2 cut(s)	73, 100
PspPPI	RGGWCCY	1 cut(s)	73
PvuI	CGATCG	1 cut(s)	12
RgaI	GCGATCGC	1 cut(s)	12
Sau3AI	GATC	1 cut(s)	9
Sau96I	GGNCC	2 cut(s)	73, 100
SetI	ASST	8 cut(s)	37, 49, 75, 105, 112, 166, 261, 285
SfaAI	GCGATCGC	1 cut(s)	12
SgfI	GCGATCGC	1 cut(s)	12
SinI	GGWCC	2 cut(s)	73, 100
SmlI	CTYRAG	1 cut(s)	260
SmoI	CTYRAG	1 cut(s)	260
SsiI	CCGC	1 cut(s)	269
SspMI	CTAG	1 cut(s)	298
StyI	CCWWGG	1 cut(s)	283
TaiI	ACGT	1 cut(s)	112
TfiI	GAWTC	1 cut(s)	41
TseFI	GTSAC	1 cut(s)	121
Tsp45I	GTSAC	1 cut(s)	121
VpaK11BI	GGWCC	2 cut(s)	73, 100
XspI	CTAG	1 cut(s)	298

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.