Rmu_sc0002094.1_g000022
ERF Family

belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002094.1
Physical Location & Seq
Reverse (-)
112933 .. 114421
1489 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002094.1_g000022.1.cds

Sequence Viewer

Length: 936 bp
atggaagtgcccagggtattcacattcagagatctggcagttgcaacgcagaacttcagccaacaatcattgattggggaaggaggaactgcaaaagtatacaaagggtatctagagactggtcagattgttgcggtcaagcgtttgaatcaagctatagcacaacggggaacaaaagaatttgatgccgaggctaatttactcagtacattacgacatccaaacatagttactttgatcgggcattgtgttgagggggaggagatgcttctcgtatacgagttcatggagctaggatcgttggtggatcacctacatgattttcgaccgagtacgacagtattaagttggaggaccagggtagaagtagccgttggcattgctaaagggctggcgtatttgcacgattccatcaatcaccatccagtgattcatagggatttaaagtcctctaacatcctactggatgcaaactttatcccaaaaatttcagattttgggatatcaaaacttggtccagtaggagaggatactcatgtctctaccgaagtcaagggcacttgcggatttttggatcccgagtatgtactctcgggacaattgactgtgaagactgatatatacagttttggcataattctttgggagctgattaccggaagaaaagcaattgaacccgatcaatcatctggaaagcaaaatatagtgcattgggcacaaccatattataataataattcggaggagcatagaaaacttgtagatccaaggcttaaaggaaaatattcaaaaaagaatatggaaaaagccatttcgttggcagcaatgtgtaccgacaggaacgctccctctcgtcctccgatgaatgaagttgctgacagtctcactgaaatcctcgaggaggcgatgacatggggaaaccgcagatgtttttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

311

Amino Acids

34.81

Weight (kDa)

6.27

Isoelectric Point (pI)

30.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 729
AbsI CCTCGAGG 1 cut(s) 896
AccI GTMKAC 2 cut(s) 99, 276
AciI CCGC 3 cut(s) 134, 564, 922
AclWI GGATC 5 cut(s) 304, 315, 569, 582, 758
AcsI RAATTY 2 cut(s) 179, 486
AcuI CTGAAG 1 cut(s) 40
AfaI GTAC 4 cut(s) 208, 334, 588, 832
AfiI CCNNNNNNNGG 1 cut(s) 901
AgsI TTSAA 3 cut(s) 148, 674, 789
AjnI CCWGG 2 cut(s) 11, 356
AjuI GAANNNNNNNTTGG 2 cut(s) 357, 389
AluBI AGCT 3 cut(s) 155, 292, 649
AluI AGCT 3 cut(s) 155, 292, 649
Alw26I GTCTC 3 cut(s) 110, 544, 887
AlwI GGATC 5 cut(s) 304, 315, 569, 582, 758
Ama87I CYCGRG 3 cut(s) 578, 592, 896
ApeKI GCWGC 1 cut(s) 821
ApoI RAATTY 2 cut(s) 179, 486
Asp700I GAANNNNTTC 1 cut(s) 784
AspS9I GGNCC 2 cut(s) 354, 515
AsuHPI GGTGA 2 cut(s) 302, 410
AvaI CYCGRG 3 cut(s) 578, 592, 896
AvaII GGWCC 2 cut(s) 354, 515
BaeGI GKGCMC 3 cut(s) 12, 560, 718
BaeI ACNNNNGTAYC 2 cut(s) 522, 555
BamHI GGATCC 1 cut(s) 574
BbsI GAAGAC 1 cut(s) 617
BbvI GCAGC 1 cut(s) 833
BccI CCATC 2 cut(s) 419, 429
BceAI ACGGC 1 cut(s) 356
BciT130I CCWGG 2 cut(s) 13, 358
BciVI GTATCC 1 cut(s) 523
BcoDI GTCTC 3 cut(s) 110, 544, 887
BfaI CTAG 2 cut(s) 113, 293
BfmI CTRYAG 1 cut(s) 156
BfuI GTATCC 1 cut(s) 523
BglII AGATCT 1 cut(s) 31
BisI GCNGC 1 cut(s) 822
BlsI GCNGC 1 cut(s) 823
Bme1390I CCNGG 2 cut(s) 13, 358
Bme18I GGWCC 2 cut(s) 354, 515
BmeT110I CYCGRG 3 cut(s) 578, 592, 896
BmgT120I GGNCC 2 cut(s) 354, 515
BmiI GGNNCC 1 cut(s) 576
BmrFI CCNGG 2 cut(s) 13, 358
BmsI GCATC 3 cut(s) 175, 255, 457
BpiI GAAGAC 1 cut(s) 617
BsaJI CCNNGG 5 cut(s) 11, 12, 189, 357, 767
BsaWI WCCGGW 1 cut(s) 656
Bsc4I CCNNNNNNNGG 1 cut(s) 901
Bse1I ACTGG 4 cut(s) 124, 425, 468, 518
Bse3DI GCAATG 2 cut(s) 378, 831
BseBI CCWGG 2 cut(s) 13, 358
BseDI CCNNGG 5 cut(s) 11, 12, 189, 357, 767
BseGI GGATG 4 cut(s) 217, 421, 456, 472
BseLI CCNNNNNNNGG 1 cut(s) 901
BseMI GCAATG 2 cut(s) 378, 831
BseMII CTCAG 1 cut(s) 217
BseNI ACTGG 4 cut(s) 124, 425, 468, 518
BseRI GAGGAG 3 cut(s) 275, 758, 914
BseSI GKGCMC 3 cut(s) 12, 560, 718
BseXI GCAGC 1 cut(s) 833
Bsh1285I CGRYCG 1 cut(s) 329
BsiEI CGRYCG 1 cut(s) 329
BsiHKCI CYCGRG 3 cut(s) 578, 592, 896
BsiSI CCGG 1 cut(s) 657
BslFI GGGAC 1 cut(s) 609
BslI CCNNNNNNNGG 1 cut(s) 901
BsmAI GTCTC 3 cut(s) 110, 544, 887
BsmFI GGGAC 1 cut(s) 609
BsoBI CYCGRG 3 cut(s) 578, 592, 896
Bsp1286I GDGCHC 3 cut(s) 12, 560, 718
Bsp143I GATC 7 cut(s) 31, 237, 296, 307, 574, 679, 763
BspACI CCGC 3 cut(s) 134, 564, 922
BspCNI CTCAG 1 cut(s) 216
BspLI GGNNCC 1 cut(s) 576
BspPI GGATC 5 cut(s) 304, 315, 569, 582, 758
BsrDI GCAATG 2 cut(s) 378, 831
BsrI ACTGG 4 cut(s) 124, 425, 468, 518
BssECI CCNNGG 5 cut(s) 11, 12, 189, 357, 767
BssMI GATC 7 cut(s) 31, 237, 296, 307, 574, 679, 763
BssNAI GTATAC 2 cut(s) 100, 277
BssT1I CCWWGG 1 cut(s) 767
Bst1107I GTATAC 2 cut(s) 100, 277
Bst2UI CCWGG 2 cut(s) 13, 358
Bst4CI ACNGT 4 cut(s) 340, 607, 626, 881
BstC8I GCNNGC 1 cut(s) 393
BstDEI CTNAG 1 cut(s) 203
BstENI CCTNNNNNAGG 1 cut(s) 899
BstF5I GGATG 4 cut(s) 217, 421, 456, 472
BstKTI GATC 7 cut(s) 34, 240, 299, 310, 577, 682, 766
BstMAI GTCTC 3 cut(s) 110, 544, 887
BstMBI GATC 7 cut(s) 31, 237, 296, 307, 574, 679, 763
BstMCI CGRYCG 1 cut(s) 329
BstNI CCWGG 2 cut(s) 13, 358
BstSCI CCNGG 2 cut(s) 11, 356
BstSFI CTRYAG 1 cut(s) 156
BstSLI GKGCMC 3 cut(s) 12, 560, 718
BstV1I GCAGC 1 cut(s) 833
BstV2I GAAGAC 1 cut(s) 617
BstX2I RGATCY 3 cut(s) 31, 574, 763
BstXI CCANNNNNNTGG 1 cut(s) 817
BstYI RGATCY 3 cut(s) 31, 574, 763
BstZ17I GTATAC 2 cut(s) 100, 277
BsuI GTATCC 1 cut(s) 523
BtgZI GCGATG 1 cut(s) 920
BtsCI GGATG 4 cut(s) 217, 421, 456, 472
BtsIMutI CAGTG 2 cut(s) 432, 885
Cac8I GCNNGC 1 cut(s) 393
Cfr13I GGNCC 2 cut(s) 354, 515
Csp6I GTAC 4 cut(s) 207, 333, 587, 831
CviAII CATG 4 cut(s) 286, 317, 536, 912
CviJI RGCY 9 cut(s) 60, 155, 194, 292, 371, 391, 649, 772, 809
CviKI_1 RGCY 9 cut(s) 60, 155, 194, 292, 371, 391, 649, 772, 809
CviQI GTAC 4 cut(s) 207, 333, 587, 831
DdeI CTNAG 1 cut(s) 203
DpnI GATC 7 cut(s) 33, 239, 298, 309, 576, 681, 765
DpnII GATC 7 cut(s) 31, 237, 296, 307, 574, 679, 763
DraI TTTAAA 1 cut(s) 444
Eco130I CCWWGG 1 cut(s) 767
Eco32I GATATC 1 cut(s) 504
Eco47I GGWCC 2 cut(s) 354, 515
Eco57I CTGAAG 1 cut(s) 40
Eco88I CYCGRG 3 cut(s) 578, 592, 896
EcoNI CCTNNNNNAGG 1 cut(s) 899
EcoRII CCWGG 2 cut(s) 11, 356
EcoRV GATATC 1 cut(s) 504
EcoT14I CCWWGG 1 cut(s) 767
ErhI CCWWGG 1 cut(s) 767
FaeI CATG 4 cut(s) 289, 320, 539, 915
FaqI GGGAC 1 cut(s) 609
FatI CATG 4 cut(s) 285, 316, 535, 911
FblI GTMKAC 2 cut(s) 99, 276
Fnu4HI GCNGC 1 cut(s) 822
FokI GGATG 4 cut(s) 204, 408, 443, 479
Fsp4HI GCNGC 1 cut(s) 822
FspBI CTAG 2 cut(s) 113, 293
GluI GCNGC 1 cut(s) 822
HapII CCGG 1 cut(s) 657
Hin1II CATG 4 cut(s) 289, 320, 539, 915
HinfI GANTC 3 cut(s) 148, 407, 430
HpaII CCGG 1 cut(s) 657
HphI GGTGA 2 cut(s) 302, 410
Hpy166II GTNNAC 3 cut(s) 100, 277, 831
Hpy188I TCNGA 5 cut(s) 29, 126, 493, 742, 861
Hpy188III TCNNGA 4 cut(s) 113, 578, 594, 690
Hpy8I GTNNAC 3 cut(s) 100, 277, 831
HpyAV CCTTC 1 cut(s) 74
HpyCH4III ACNGT 4 cut(s) 340, 607, 626, 881
HpyCH4V TGCA 5 cut(s) 44, 92, 403, 470, 709
HpyF3I CTNAG 1 cut(s) 203
Hsp92II CATG 4 cut(s) 289, 320, 539, 915
Kzo9I GATC 7 cut(s) 31, 237, 296, 307, 574, 679, 763
LmnI GCTCC 4 cut(s) 289, 646, 745, 850
Lsp1109I GCAGC 1 cut(s) 833
LweI GCATC 3 cut(s) 175, 255, 457
MaeI CTAG 2 cut(s) 113, 293
MaeIII GTNAC 1 cut(s) 229
MalI GATC 7 cut(s) 33, 239, 298, 309, 576, 681, 765
MboI GATC 7 cut(s) 31, 237, 296, 307, 574, 679, 763
MboII GAAGA 2 cut(s) 622, 672
MfeI CAATTG 2 cut(s) 599, 669
MflI RGATCY 3 cut(s) 31, 574, 763
MhlI GDGCHC 3 cut(s) 12, 560, 718
MluCI AATT 7 cut(s) 179, 196, 486, 599, 636, 669, 736
MmeI TCCRAC 1 cut(s) 329
MroXI GAANNNNTTC 1 cut(s) 784
MseI TTAA 3 cut(s) 344, 443, 774
MslI CAYNNNNRTG 1 cut(s) 315
MspI CCGG 1 cut(s) 657
MspR9I CCNGG 2 cut(s) 13, 358
MunI CAATTG 2 cut(s) 599, 669
MvaI CCWGG 2 cut(s) 13, 358
NdeII GATC 7 cut(s) 31, 237, 296, 307, 574, 679, 763
NlaIII CATG 4 cut(s) 289, 320, 539, 915
NlaIV GGNNCC 1 cut(s) 576
NmeAIII GCCGAG 1 cut(s) 214
PaeR7I CTCGAG 1 cut(s) 896
PasI CCCWGGG 1 cut(s) 12
PdmI GAANNNNTTC 1 cut(s) 784
PfeI GAWTC 3 cut(s) 148, 407, 430
PkrI GCNGC 1 cut(s) 823
PsiI TTATAA 1 cut(s) 729
Psp6I CCWGG 2 cut(s) 11, 356
PspGI CCWGG 2 cut(s) 11, 356
PspN4I GGNNCC 1 cut(s) 576
PspPI GGNCC 2 cut(s) 354, 515
PspXI VCTCGAGB 1 cut(s) 896
PsuI RGATCY 3 cut(s) 31, 574, 763
RsaI GTAC 4 cut(s) 208, 334, 588, 832
RsaNI GTAC 4 cut(s) 207, 333, 587, 831
RseI CAYNNNNRTG 1 cut(s) 315
SaqAI TTAA 3 cut(s) 344, 443, 774
SatI GCNGC 1 cut(s) 822
Sau3AI GATC 7 cut(s) 31, 237, 296, 307, 574, 679, 763
Sau96I GGNCC 2 cut(s) 354, 515
ScrFI CCNGG 2 cut(s) 13, 358
SduI GDGCHC 3 cut(s) 12, 560, 718
SetI ASST 4 cut(s) 157, 294, 315, 651
SfaNI GCATC 3 cut(s) 175, 255, 457
SfcI CTRYAG 1 cut(s) 156
Sfr274I CTCGAG 1 cut(s) 896
SinI GGWCC 2 cut(s) 354, 515
SlaI CTCGAG 1 cut(s) 896
SmiMI CAYNNNNRTG 1 cut(s) 315
SmlI CTYRAG 1 cut(s) 896
SmoI CTYRAG 1 cut(s) 896
Sse9I AATT 7 cut(s) 179, 196, 486, 599, 636, 669, 736
SsiI CCGC 3 cut(s) 134, 564, 922
SspI AATATT 1 cut(s) 785
SspMI CTAG 2 cut(s) 113, 293
StyD4I CCNGG 2 cut(s) 11, 356
StyI CCWWGG 1 cut(s) 767
TaaI ACNGT 4 cut(s) 340, 607, 626, 881
TaqI TCGA 2 cut(s) 325, 897
TaqII GACCGA 1 cut(s) 343
TasI AATT 7 cut(s) 179, 196, 486, 599, 636, 669, 736
TatI WGTACW 2 cut(s) 206, 586
TfiI GAWTC 3 cut(s) 148, 407, 430
Tru1I TTAA 3 cut(s) 344, 443, 774
Tru9I TTAA 3 cut(s) 344, 443, 774
TscAI CASTG 2 cut(s) 432, 892
TseI GCWGC 1 cut(s) 821
TspDTI ATGAA 4 cut(s) 274, 422, 878, 882
TspRI CASTG 2 cut(s) 432, 892
VpaK11BI GGWCC 2 cut(s) 354, 515
XagI CCTNNNNNAGG 1 cut(s) 899
XapI RAATTY 2 cut(s) 179, 486
XbaI TCTAGA 1 cut(s) 112
XhoI CTCGAG 1 cut(s) 896
XmiI GTMKAC 2 cut(s) 99, 276
XmnI GAANNNNTTC 1 cut(s) 784
XspI CTAG 2 cut(s) 113, 293
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.