Rmu_sc0002251.1_g000005

Protein of unknown function (DUF1218)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002251.1
Physical Location & Seq
Reverse (-)
18674 .. 20080
1407 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002251.1_g000005.1.cds

Sequence Viewer

Length: 609 bp
atggcagtctccgttcccatagtggccatcatcacctctctccacctcatcgccttcattttcgccgtcggcgccgaacgacgccgtagcaccgcgaagatagtgcccgacgagtacgacgagcaaacctactgcgtttacggcaccgacgcttccaccgtgtacggactggccgcgttcgggcttcttctgctcagccacacggtgcttaacggcgtcaccaggtgtctctgcttcggcaaaggcttaatcaccggctcctctactacttggactgtcttcttcttcgtcttctcctggacaacctttttgggagccgaggcatgcttattggcagggtcagcaaggaatgcctatcacacaaagtacagggggaaatttaacctagacgacttgtcctgtgccactctccgtaagggcgtgtttgctgcagcagctgctcttacactgttgtcgctgatagggtcaaacctttactactggacacattccaaagctgatactggagggtgggagaagcaccgcaatgaaggccttggcatgggcaattccaattatgggcagcacgagcagcagctgcagcaaaccactggattcgagaaggtgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

202

Amino Acids

22.03

Weight (kDa)

8.26

Isoelectric Point (pI)

21.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 71, 143
AccII CGCG 2 cut(s) 95, 176
AciI CCGC 3 cut(s) 93, 174, 523
AcoI YGGCCR 2 cut(s) 24, 171
AcsI RAATTY 1 cut(s) 377
AcyI GRCGYC 3 cut(s) 72, 82, 216
AdeI CACNNNGTG 2 cut(s) 205, 225
AfaI GTAC 3 cut(s) 116, 164, 368
AfiI CCNNNNNNNGG 3 cut(s) 180, 541, 558
AhdI GACNNNNNGTC 1 cut(s) 394
AjnI CCWGG 2 cut(s) 221, 296
AluBI AGCT 3 cut(s) 437, 497, 577
AluI AGCT 3 cut(s) 437, 497, 577
Alw26I GTCTC 2 cut(s) 13, 233
AlwNI CAGNNNCTG 2 cut(s) 437, 577
AoxI GGCC 3 cut(s) 24, 171, 532
ApeKI GCWGC 9 cut(s) 428, 431, 434, 437, 562, 571, 574, 577, 580
ApoI RAATTY 1 cut(s) 377
ArsI GACNNNNNNTTYG 2 cut(s) 292, 324
AspLEI GCGC 1 cut(s) 74
AsuHPI GGTGA 3 cut(s) 25, 211, 244
BaeGI GKGCMC 1 cut(s) 108
BalI TGGCCA 1 cut(s) 26
BanI GGYRCC 2 cut(s) 71, 143
BauI CACGAG 1 cut(s) 566
BbsI GAAGAC 2 cut(s) 271, 283
BbvI GCAGC 9 cut(s) 415, 424, 443, 446, 564, 574, 583, 586, 592
BccI CCATC 1 cut(s) 35
BceAI ACGGC 4 cut(s) 50, 69, 157, 229
BcgI CGANNNNNNTGC 2 cut(s) 85, 119
BciT130I CCWGG 2 cut(s) 223, 298
BcoDI GTCTC 2 cut(s) 13, 233
BfaI CTAG 1 cut(s) 386
BfmI CTRYAG 2 cut(s) 429, 578
BfoI RGCGCY 1 cut(s) 75
BlpI GCTNAGC 1 cut(s) 194
Bme1390I CCNGG 2 cut(s) 223, 298
BmeRI GACNNNNNGTC 1 cut(s) 394
BmiI GGNNCC 4 cut(s) 73, 145, 259, 316
BmrFI CCNGG 2 cut(s) 223, 298
BpiI GAAGAC 2 cut(s) 271, 283
BpmI CTGGAG 1 cut(s) 525
Bpu1102I GCTNAGC 1 cut(s) 194
BsaHI GRCGYC 3 cut(s) 72, 82, 216
BsaJI CCNNGG 2 cut(s) 318, 535
Bsc4I CCNNNNNNNGG 3 cut(s) 180, 541, 558
Bse118I RCCGGY 1 cut(s) 254
Bse1I ACTGG 4 cut(s) 174, 485, 508, 595
Bse3DI GCAATG 1 cut(s) 532
BseBI CCWGG 2 cut(s) 223, 298
BseDI CCNNGG 2 cut(s) 318, 535
BseLI CCNNNNNNNGG 3 cut(s) 180, 541, 558
BseMI GCAATG 1 cut(s) 532
BseMII CTCAG 1 cut(s) 208
BseNI ACTGG 4 cut(s) 174, 485, 508, 595
BseRI GAGGAG 1 cut(s) 250
BseSI GKGCMC 1 cut(s) 108
BseXI GCAGC 9 cut(s) 415, 424, 443, 446, 564, 574, 583, 586, 592
Bsh1236I CGCG 2 cut(s) 95, 176
BshFI GGCC 3 cut(s) 26, 173, 534
BshNI GGYRCC 2 cut(s) 71, 143
BsiSI CCGG 1 cut(s) 255
BslI CCNNNNNNNGG 3 cut(s) 180, 541, 558
BsmAI GTCTC 2 cut(s) 13, 233
BsmI GAATGC 1 cut(s) 355
BsnI GGCC 3 cut(s) 26, 173, 534
Bsp1286I GDGCHC 1 cut(s) 108
Bsp1720I GCTNAGC 1 cut(s) 194
BspACI CCGC 3 cut(s) 93, 174, 523
BspANI GGCC 3 cut(s) 26, 173, 534
BspCNI CTCAG 1 cut(s) 207
BspFNI CGCG 2 cut(s) 95, 176
BspLI GGNNCC 4 cut(s) 73, 145, 259, 316
BspMAI CTGCAG 2 cut(s) 433, 582
BspT107I GGYRCC 2 cut(s) 71, 143
BsrDI GCAATG 1 cut(s) 532
BsrFI RCCGGY 1 cut(s) 254
BsrI ACTGG 4 cut(s) 174, 485, 508, 595
BssAI RCCGGY 1 cut(s) 254
BssECI CCNNGG 2 cut(s) 318, 535
BssNI GRCGYC 3 cut(s) 72, 82, 216
BssSI CACGAG 1 cut(s) 566
BssT1I CCWWGG 1 cut(s) 535
Bst2BI CACGAG 1 cut(s) 566
Bst2UI CCWGG 2 cut(s) 223, 298
Bst4CI ACNGT 4 cut(s) 160, 205, 277, 450
BstACI GRCGYC 3 cut(s) 72, 82, 216
BstAPI GCANNNNNTGC 3 cut(s) 350, 437, 577
BstC8I GCNNGC 1 cut(s) 325
BstDEI CTNAG 1 cut(s) 194
BstFNI CGCG 2 cut(s) 95, 176
BstH2I RGCGCY 1 cut(s) 75
BstHHI GCGC 1 cut(s) 74
BstMAI GTCTC 2 cut(s) 13, 233
BstNI CCWGG 2 cut(s) 223, 298
BstNSI RCATGY 1 cut(s) 327
BstSCI CCNGG 2 cut(s) 221, 296
BstSFI CTRYAG 2 cut(s) 429, 578
BstSLI GKGCMC 1 cut(s) 108
BstUI CGCG 2 cut(s) 95, 176
BstV1I GCAGC 9 cut(s) 415, 424, 443, 446, 564, 574, 583, 586, 592
BstV2I GAAGAC 2 cut(s) 271, 283
BsuRI GGCC 3 cut(s) 26, 173, 534
BtgZI GCGATG 1 cut(s) 34
BtsIMutI CAGTG 2 cut(s) 446, 588
Cac8I GCNNGC 1 cut(s) 325
CaiI CAGNNNCTG 2 cut(s) 437, 577
CfoI GCGC 1 cut(s) 74
Cfr10I RCCGGY 1 cut(s) 254
CseI GACGC 3 cut(s) 90, 158, 205
CsiI ACCWGGT 1 cut(s) 221
Csp6I GTAC 3 cut(s) 115, 163, 367
CviAII CATG 2 cut(s) 324, 541
CviQI GTAC 3 cut(s) 115, 163, 367
DdeI CTNAG 1 cut(s) 194
DinI GGCGCC 1 cut(s) 73
DraIII CACNNNGTG 2 cut(s) 205, 225
DriI GACNNNNNGTC 1 cut(s) 394
EaeI YGGCCR 2 cut(s) 24, 171
Eam1105I GACNNNNNGTC 1 cut(s) 394
Eco130I CCWWGG 1 cut(s) 535
Eco147I AGGCCT 1 cut(s) 534
EcoRII CCWGG 2 cut(s) 221, 296
EcoT14I CCWWGG 1 cut(s) 535
EgeI GGCGCC 1 cut(s) 73
EheI GGCGCC 1 cut(s) 73
ErhI CCWWGG 1 cut(s) 535
FaeI CATG 2 cut(s) 327, 544
FaiI YATR 4 cut(s) 20, 325, 542, 558
FatI CATG 2 cut(s) 323, 540
FspBI CTAG 1 cut(s) 386
GlaI GCGC 1 cut(s) 73
GsuI CTGGAG 1 cut(s) 525
HaeII RGCGCY 1 cut(s) 75
HaeIII GGCC 3 cut(s) 26, 173, 534
HapII CCGG 1 cut(s) 255
HgaI GACGC 3 cut(s) 90, 158, 205
HhaI GCGC 1 cut(s) 74
Hin1I GRCGYC 3 cut(s) 72, 82, 216
Hin1II CATG 2 cut(s) 327, 544
Hin6I GCGC 1 cut(s) 72
HinP1I GCGC 1 cut(s) 72
HinfI GANTC 1 cut(s) 594
HpaII CCGG 1 cut(s) 255
HphI GGTGA 3 cut(s) 25, 211, 244
Hpy166II GTNNAC 2 cut(s) 139, 163
Hpy188III TCNNGA 1 cut(s) 598
Hpy8I GTNNAC 2 cut(s) 139, 163
Hpy99I CGWCG 5 cut(s) 71, 84, 113, 122, 152
HpyAV CCTTC 3 cut(s) 64, 524, 595
HpyCH4III ACNGT 4 cut(s) 160, 205, 277, 450
HpyCH4V TGCA 2 cut(s) 431, 580
HpyF3I CTNAG 1 cut(s) 194
Hsp92I GRCGYC 3 cut(s) 72, 82, 216
Hsp92II CATG 2 cut(s) 327, 544
HspAI GCGC 1 cut(s) 72
KasI GGCGCC 1 cut(s) 71
LmnI GCTCC 2 cut(s) 263, 314
Lsp1109I GCAGC 9 cut(s) 415, 424, 443, 446, 564, 574, 583, 586, 592
MabI ACCWGGT 1 cut(s) 221
MaeI CTAG 1 cut(s) 386
MaeIII GTNAC 1 cut(s) 217
MboII GAAGA 6 cut(s) 109, 179, 271, 274, 277, 283
MhlI GDGCHC 1 cut(s) 108
MlsI TGGCCA 1 cut(s) 26
MluCI AATT 3 cut(s) 377, 547, 553
MluNI TGGCCA 1 cut(s) 26
Mly113I GGCGCC 1 cut(s) 72
MnlI CCTC 5 cut(s) 46, 56, 271, 313, 500
Mox20I TGGCCA 1 cut(s) 26
MscI TGGCCA 1 cut(s) 26
MseI TTAA 3 cut(s) 210, 248, 381
MslI CAYNNNNRTG 1 cut(s) 525
Msp20I TGGCCA 1 cut(s) 26
MspA1I CMGCKG 2 cut(s) 437, 577
MspI CCGG 1 cut(s) 255
MspR9I CCNGG 2 cut(s) 223, 298
Mva1269I GAATGC 1 cut(s) 355
MvaI CCWGG 2 cut(s) 223, 298
MvnI CGCG 2 cut(s) 95, 176
NarI GGCGCC 1 cut(s) 72
NlaIII CATG 2 cut(s) 327, 544
NlaIV GGNNCC 4 cut(s) 73, 145, 259, 316
NmeAIII GCCGAG 1 cut(s) 343
NmuCI GTSAC 1 cut(s) 217
NspI RCATGY 1 cut(s) 327
PaeI GCATGC 1 cut(s) 327
PceI AGGCCT 1 cut(s) 534
PcsI WCGNNNNNNNCGW 2 cut(s) 117, 156
PctI GAATGC 1 cut(s) 355
PfeI GAWTC 1 cut(s) 594
PfoI TCCNGGA 1 cut(s) 296
PluTI GGCGCC 1 cut(s) 75
Psp6I CCWGG 2 cut(s) 221, 296
PspGI CCWGG 2 cut(s) 221, 296
PspN4I GGNNCC 4 cut(s) 73, 145, 259, 316
PstI CTGCAG 2 cut(s) 433, 582
PstNI CAGNNNCTG 2 cut(s) 437, 577
PvuII CAGCTG 2 cut(s) 437, 577
RsaI GTAC 3 cut(s) 116, 164, 368
RsaNI GTAC 3 cut(s) 115, 163, 367
RseI CAYNNNNRTG 1 cut(s) 525
SaqAI TTAA 3 cut(s) 210, 248, 381
ScrFI CCNGG 2 cut(s) 223, 298
SduI GDGCHC 1 cut(s) 108
SexAI ACCWGGT 1 cut(s) 221
SfcI CTRYAG 2 cut(s) 429, 578
SfoI GGCGCC 1 cut(s) 73
SmiMI CAYNNNNRTG 1 cut(s) 525
SphI GCATGC 1 cut(s) 327
Sse9I AATT 3 cut(s) 377, 547, 553
SseBI AGGCCT 1 cut(s) 534
SsiI CCGC 3 cut(s) 93, 174, 523
SspDI GGCGCC 1 cut(s) 71
SspMI CTAG 1 cut(s) 386
StuI AGGCCT 1 cut(s) 534
StyD4I CCNGG 2 cut(s) 221, 296
StyI CCWWGG 1 cut(s) 535
TaaI ACNGT 4 cut(s) 160, 205, 277, 450
TaqI TCGA 1 cut(s) 597
TasI AATT 3 cut(s) 377, 547, 553
TatI WGTACW 1 cut(s) 366
TauI GCSGC 1 cut(s) 176
TfiI GAWTC 1 cut(s) 594
Tru1I TTAA 3 cut(s) 210, 248, 381
Tru9I TTAA 3 cut(s) 210, 248, 381
TscAI CASTG 2 cut(s) 453, 595
TseFI GTSAC 1 cut(s) 217
TseI GCWGC 9 cut(s) 428, 431, 434, 437, 562, 571, 574, 577, 580
Tsp45I GTSAC 1 cut(s) 217
TspDTI ATGAA 2 cut(s) 46, 543
TspGWI ACGGA 2 cut(s) 180, 401
TspRI CASTG 2 cut(s) 453, 595
XapI RAATTY 1 cut(s) 377
XceI RCATGY 1 cut(s) 327
XspI CTAG 1 cut(s) 386
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.