Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002530.1

Orthogroup ID

OG0005059

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 11370

Gene Structure 11370 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002530.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1268 bp

atattaatggtaaagggttggcatctgagacacctacaaattgcagtgcagttactgggagcggaaatagcaagttagctggtgtagatcttctaaacgatgagatagtctgtgaacaactaacaagaaacattcaattctttggacttgaacctcaacaaaaagtgactgcttcctatgttgtggtcattggtcttggaggagttggaagtcatgctgcatcaatgcttttgcggtcgggggttggcaggcttctccttgtggactttgatcaggtatcagtttcatcacttaatcgacatgctgttgcaacaagagctgacgttggtatcccaaaagcccagtgtctaaaagatcatttcttgtctatcttcccagagtgtctcatagaagcaaaggtcctgttatacaatgcatcgtctgaggaagagattctttcgggtcatcctgattttgttttggactgcattgacaacattgatacaaaggtggcacttcttgcggcatgtgtacgtaggggtttaaaggtcctatcagccacaggagctggtgctagagctgacccgacaagaatacgcattgctgatttaagacaatcgacaaatgacccattatctcgagctgtgagacaccgtttgaagagagagtatggcattgaaggtggcattcctgttgtattttcattggagaaacctaaggcaaagcttcttccatttaaaggacaaagtggagaagaagaaaatccttcagattaccagatagtaccagggtttagggttcgcataatacctgtccttggtaccattcctgcaatatttggccaagtgatggcctcctatgtgttgacacaacttgcagaattgcaagttcaattggaacctgtgataaacttggacattgaccattaccggatgcttcaccaacgtcttattgagcatgaggagtcattgtatggcactgccttgcatgtcctggtagatgttgaagaagtgatgtatgttgcaaaagagttgtggcatggaagaagtgctagagagccatttgctaaagatgtaggacgtagcatgtggcgatcggtgaatgaattaatgcttttgaggtgggaccgggaaaagccggcatctgtgtccaacttaattctattgaaatttaaagaggcagatgaacatgaatccaggactcttgaagatataaaagaggaggaaccagaattttttgttcgagttacatctgttctgaagcgagccgaagtagaatttggcttgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ThiF

Protein Analysis

421

Amino Acids

46.64

Weight (kDa)

5.75

Isoelectric Point (pI)

41.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005059)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G37530 AT5G37530
fragaria_vesca	FvH4_1g29991 FvH4_1g29991 FvH4_1g29991 FvH4_1g29991 FvH4_1g29991 FvH4_1g29991 FvH4_1g29991 FvH4_1g29991 FvH4_1g29991 FvH4_1g29991 FvH4_1g29991 FvH4_1g29991
malus_domestica	MD09G1267400.v1.1
prunus_persica	Prupe.3G165000_v2.0.a1 Prupe.3G165000_v2.0.a1
pyrus_communis	pycom09g18020 pycom09g18030
rosa_chinensis	RchiOBHm_Chr3g0492321
rosa_laevigata	RLG00000022783
rosa_multiflora	Rmu_sc0002530.1_g000001
rosa_roxburghii	Rroxscaffold_6G00392430
rosa_rugosa	Rorug03G0253100 Rorug03G0253200
rosa_samantha	Rh3AG303100 Rh3BG339100 Rh3CG336300 Rh3DG338300
rosa_wichuraiana	Rw3G026740

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	799
AccB1I	GGYRCC	1 cut(s)	799
AccB7I	CCANNNNNTGG	1 cut(s)	828
AccBSI	CCGCTC	1 cut(s)	62
AciI	CCGC	3 cut(s)	62, 234, 502
AcoI	YGGCCR	1 cut(s)	819
AcsI	RAATTY	3 cut(s)	1147, 1210, 1255
AcuI	CTGAAG	2 cut(s)	731, 1258
AfaI	GTAC	3 cut(s)	512, 764, 801
AfiI	CCNNNNNNNGG	3 cut(s)	718, 796, 828
AgsI	TTSAA	8 cut(s)	136, 151, 639, 658, 871, 985, 1146, 1186
AjnI	CCWGG	3 cut(s)	765, 971, 1174
AjuI	GAANNNNNNNTTGG	1 cut(s)	1241
AluBI	AGCT	6 cut(s)	79, 319, 547, 559, 622, 705
AluI	AGCT	6 cut(s)	79, 319, 547, 559, 622, 705
Alw26I	GTCTC	3 cut(s)	22, 388, 621
AlwNI	CAGNNNCTG	2 cut(s)	55, 547
Ama87I	CYCGRG	1 cut(s)	617
AoxI	GGCC	2 cut(s)	819, 830
ApeKI	GCWGC	1 cut(s)	217
ApoI	RAATTY	3 cut(s)	1147, 1210, 1255
AseI	ATTAAT	2 cut(s)	5, 1087
Asp700I	GAANNNNTTC	1 cut(s)	431
Asp718I	GGTACC	1 cut(s)	799
AspS9I	GGNCC	3 cut(s)	399, 528, 1104
AsuC2I	CCSGG	1 cut(s)	1108
AsuHPI	GGTGA	2 cut(s)	910, 1089
AvaI	CYCGRG	1 cut(s)	617
AvaII	GGWCC	3 cut(s)	399, 528, 1104
AxyI	CCTNAGG	1 cut(s)	695
BaeI	ACNNNNGTAYC	4 cut(s)	312, 345, 473, 506
BalI	TGGCCA	1 cut(s)	821
BanI	GGYRCC	1 cut(s)	799
BbvI	GCAGC	1 cut(s)	204
BccI	CCATC	1 cut(s)	822
BciT130I	CCWGG	3 cut(s)	767, 973, 1176
BciVI	GTATCC	1 cut(s)	340
BclI	TGATCA	1 cut(s)	270
BcnI	CCSGG	1 cut(s)	1108
BcoDI	GTCTC	3 cut(s)	22, 388, 621
BfaI	CTAG	2 cut(s)	554, 1031
BfuI	GTATCC	1 cut(s)	340
BglII	AGATCT	1 cut(s)	87
BisI	GCNGC	2 cut(s)	218, 503
BlsI	GCNGC	2 cut(s)	219, 504
Bme1390I	CCNGG	4 cut(s)	767, 973, 1108, 1176
Bme18I	GGWCC	3 cut(s)	399, 528, 1104
BmeT110I	CYCGRG	1 cut(s)	617
BmgT120I	GGNCC	3 cut(s)	399, 528, 1104
BmiI	GGNNCC	4 cut(s)	801, 878, 1105, 1205
BmrFI	CCNGG	4 cut(s)	767, 973, 1108, 1176
BmrI	ACTGGG	2 cut(s)	65, 336
BmsI	GCATC	5 cut(s)	31, 229, 424, 902, 1129
BmuI	ACTGGG	2 cut(s)	65, 336
BpuMI	CCSGG	1 cut(s)	1108
BsaAI	YACGTR	1 cut(s)	514
BsaJI	CCNNGG	2 cut(s)	766, 795
BsaWI	WCCGGW	1 cut(s)	908
BsaXI	ACNNNNNCTCC	2 cut(s)	934, 964
Bsc4I	CCNNNNNNNGG	3 cut(s)	718, 796, 828
Bse118I	RCCGGY	1 cut(s)	1116
Bse1I	ACTGG	2 cut(s)	60, 342
Bse21I	CCTNAGG	1 cut(s)	695
Bse3DI	GCAATG	1 cut(s)	578
BseBI	CCWGG	3 cut(s)	767, 973, 1176
BseDI	CCNNGG	2 cut(s)	766, 795
BseGI	GGATG	2 cut(s)	444, 917
BseLI	CCNNNNNNNGG	3 cut(s)	718, 796, 828
BseMI	GCAATG	1 cut(s)	578
BseMII	CTCAG	2 cut(s)	17, 413
BseNI	ACTGG	2 cut(s)	60, 342
BseRI	GAGGAG	3 cut(s)	215, 955, 1213
BseXI	GCAGC	1 cut(s)	204
BsgI	GTGCAG	1 cut(s)	68
Bsh1285I	CGRYCG	2 cut(s)	238, 1075
BshFI	GGCC	2 cut(s)	821, 832
BshNI	GGYRCC	1 cut(s)	799
BsiEI	CGRYCG	2 cut(s)	238, 1075
BsiHKCI	CYCGRG	1 cut(s)	617
BsiSI	CCGG	3 cut(s)	909, 1107, 1117
BslFI	GGGAC	1 cut(s)	1117
BslI	CCNNNNNNNGG	3 cut(s)	718, 796, 828
BsmAI	GTCTC	3 cut(s)	22, 388, 621
BsmFI	GGGAC	1 cut(s)	1117
BsmI	GAATGC	1 cut(s)	665
BsnI	GGCC	2 cut(s)	821, 832
BsoBI	CYCGRG	1 cut(s)	617
Bsp143I	GATC	4 cut(s)	87, 270, 354, 1072
BspACI	CCGC	3 cut(s)	62, 234, 502
BspANI	GGCC	2 cut(s)	821, 832
BspCNI	CTCAG	2 cut(s)	18, 414
BspLI	GGNNCC	4 cut(s)	801, 878, 1105, 1205
BspT107I	GGYRCC	1 cut(s)	799
BsrBI	CCGCTC	1 cut(s)	62
BsrDI	GCAATG	1 cut(s)	578
BsrFI	RCCGGY	1 cut(s)	1116
BsrI	ACTGG	2 cut(s)	60, 342
BssAI	RCCGGY	1 cut(s)	1116
BssECI	CCNNGG	2 cut(s)	766, 795
BssMI	GATC	4 cut(s)	87, 270, 354, 1072
BssT1I	CCWWGG	1 cut(s)	795
Bst2UI	CCWGG	3 cut(s)	767, 973, 1176
Bst4CI	ACNGT	1 cut(s)	634
Bst6I	CTCTTC	2 cut(s)	422, 634
BstAPI	GCANNNNNTGC	1 cut(s)	499
BstBAI	YACGTR	1 cut(s)	514
BstC8I	GCNNGC	3 cut(s)	250, 1118, 1244
BstDEI	CTNAG	3 cut(s)	26, 422, 695
BstF5I	GGATG	2 cut(s)	444, 917
BstKTI	GATC	4 cut(s)	90, 273, 357, 1075
BstMAI	GTCTC	3 cut(s)	22, 388, 621
BstMBI	GATC	4 cut(s)	87, 270, 354, 1072
BstMCI	CGRYCG	2 cut(s)	238, 1075
BstMWI	GCNNNNNNNGC	4 cut(s)	68, 316, 499, 544
BstNI	CCWGG	3 cut(s)	767, 973, 1176
BstNSI	RCATGY	4 cut(s)	304, 509, 970, 1068
BstSCI	CCNGG	4 cut(s)	765, 971, 1106, 1174
BstSNI	TACGTA	1 cut(s)	514
BstV1I	GCAGC	1 cut(s)	204
BstX2I	RGATCY	1 cut(s)	87
BstYI	RGATCY	1 cut(s)	87
Bsu36I	CCTNAGG	1 cut(s)	695
BsuI	GTATCC	1 cut(s)	340
BsuRI	GGCC	2 cut(s)	821, 832
BtsCI	GGATG	2 cut(s)	444, 917
BtsI	GCAGTG	2 cut(s)	51, 956
BtsIMutI	CAGTG	3 cut(s)	51, 349, 956
Cac8I	GCNNGC	3 cut(s)	250, 1118, 1244
CaiI	CAGNNNCTG	2 cut(s)	55, 547
Cfr10I	RCCGGY	1 cut(s)	1116
Cfr13I	GGNCC	3 cut(s)	399, 528, 1104
Csp6I	GTAC	3 cut(s)	511, 763, 800
CviAII	CATG	8 cut(s)	214, 301, 506, 937, 967, 1018, 1065, 1168
CviQI	GTAC	3 cut(s)	511, 763, 800
DdeI	CTNAG	3 cut(s)	26, 422, 695
DpnI	GATC	4 cut(s)	89, 272, 356, 1074
DpnII	GATC	4 cut(s)	87, 270, 354, 1072
DraI	TTTAAA	3 cut(s)	524, 717, 1152
EaeI	YGGCCR	1 cut(s)	819
Eam1104I	CTCTTC	2 cut(s)	422, 634
EarI	CTCTTC	2 cut(s)	422, 634
Eco105I	TACGTA	1 cut(s)	514
Eco130I	CCWWGG	1 cut(s)	795
Eco47I	GGWCC	3 cut(s)	399, 528, 1104
Eco57I	CTGAAG	2 cut(s)	731, 1258
Eco81I	CCTNAGG	1 cut(s)	695
Eco88I	CYCGRG	1 cut(s)	617
EcoO109I	RGGNCCY	2 cut(s)	399, 528
EcoRII	CCWGG	3 cut(s)	765, 971, 1174
EcoT14I	CCWWGG	1 cut(s)	795
EcoT22I	ATGCAT	1 cut(s)	417
ErhI	CCWWGG	1 cut(s)	795
FaeI	CATG	8 cut(s)	217, 304, 509, 940, 970, 1021, 1068, 1171
FalI	AAGNNNNNCTT	2 cut(s)	419, 451
FaqI	GGGAC	1 cut(s)	1117
FatI	CATG	8 cut(s)	213, 300, 505, 936, 966, 1017, 1064, 1167
FbaI	TGATCA	1 cut(s)	270
Fnu4HI	GCNGC	2 cut(s)	218, 503
FokI	GGATG	2 cut(s)	431, 924
Fsp4HI	GCNGC	2 cut(s)	218, 503
FspBI	CTAG	2 cut(s)	554, 1031
GluI	GCNGC	2 cut(s)	218, 503
HaeIII	GGCC	2 cut(s)	821, 832
HapII	CCGG	3 cut(s)	909, 1107, 1117
Hin1II	CATG	8 cut(s)	217, 304, 509, 940, 970, 1021, 1068, 1171
HincII	GTYRAC	1 cut(s)	845
HindII	GTYRAC	1 cut(s)	845
HindIII	AAGCTT	1 cut(s)	703
HinfI	GANTC	4 cut(s)	432, 943, 1171, 1179
HpaII	CCGG	3 cut(s)	909, 1107, 1117
HphI	GGTGA	2 cut(s)	910, 1089
Hpy166II	GTNNAC	4 cut(s)	115, 264, 511, 845
Hpy188I	TCNGA	4 cut(s)	27, 423, 750, 1238
Hpy188III	TCNNGA	3 cut(s)	448, 617, 1183
Hpy8I	GTNNAC	4 cut(s)	115, 264, 511, 845
HpyAV	CCTTC	2 cut(s)	652, 755
HpyCH4III	ACNGT	1 cut(s)	634
HpyCH4IV	ACGT	4 cut(s)	323, 513, 924, 1059
HpyF10VI	GCNNNNNNNGC	4 cut(s)	68, 316, 499, 544
HpyF3I	CTNAG	3 cut(s)	26, 422, 695
HpySE526I	ACGT	4 cut(s)	323, 513, 924, 1059
Hsp92II	CATG	8 cut(s)	217, 304, 509, 940, 970, 1021, 1068, 1171
KpnI	GGTACC	1 cut(s)	803
KroI	GCCGGC	1 cut(s)	1116
KroNI	GCCGGC	1 cut(s)	1118
Ksp22I	TGATCA	1 cut(s)	270
Kzo9I	GATC	4 cut(s)	87, 270, 354, 1072
LmnI	GCTCC	2 cut(s)	59, 544
Lsp1109I	GCAGC	1 cut(s)	204
LweI	GCATC	5 cut(s)	31, 229, 424, 902, 1129
MaeI	CTAG	2 cut(s)	554, 1031
MaeII	ACGT	4 cut(s)	323, 513, 924, 1059
MaeIII	GTNAC	3 cut(s)	51, 165, 1224
MalI	GATC	4 cut(s)	89, 272, 356, 1074
MbiI	CCGCTC	1 cut(s)	62
MboI	GATC	4 cut(s)	87, 270, 354, 1072
MfeI	CAATTG	1 cut(s)	871
MflI	RGATCY	1 cut(s)	87
MlsI	TGGCCA	1 cut(s)	821
MluCI	AATT	9 cut(s)	39, 136, 859, 871, 1084, 1136, 1147, 1210, 1255
MluNI	TGGCCA	1 cut(s)	821
MlyI	GAGTC	2 cut(s)	952, 1173
MmeI	TCCRAC	2 cut(s)	186, 1154
MnlI	CCTC	9 cut(s)	164, 193, 417, 843, 933, 1091, 1149, 1191, 1194
Mox20I	TGGCCA	1 cut(s)	821
Mph1103I	ATGCAT	1 cut(s)	417
MroNI	GCCGGC	1 cut(s)	1116
MroXI	GAANNNNTTC	1 cut(s)	431
MscI	TGGCCA	1 cut(s)	821
MseI	TTAA	8 cut(s)	5, 293, 523, 589, 716, 1087, 1135, 1151
Msp20I	TGGCCA	1 cut(s)	821
MspI	CCGG	3 cut(s)	909, 1107, 1117
MspR9I	CCNGG	4 cut(s)	767, 973, 1108, 1176
MunI	CAATTG	1 cut(s)	871
Mva1269I	GAATGC	1 cut(s)	665
MvaI	CCWGG	3 cut(s)	767, 973, 1176
MwoI	GCNNNNNNNGC	4 cut(s)	68, 316, 499, 544
NaeI	GCCGGC	1 cut(s)	1118
NciI	CCSGG	1 cut(s)	1108
NdeII	GATC	4 cut(s)	87, 270, 354, 1072
NgoMIV	GCCGGC	1 cut(s)	1116
NlaIII	CATG	8 cut(s)	217, 304, 509, 940, 970, 1021, 1068, 1171
NlaIV	GGNNCC	4 cut(s)	801, 878, 1105, 1205
NmuCI	GTSAC	1 cut(s)	165
NsiI	ATGCAT	1 cut(s)	417
NspI	RCATGY	4 cut(s)	304, 509, 970, 1068
PaeR7I	CTCGAG	1 cut(s)	617
PctI	GAATGC	1 cut(s)	665
PdiI	GCCGGC	1 cut(s)	1118
PdmI	GAANNNNTTC	1 cut(s)	431
PfeI	GAWTC	2 cut(s)	432, 1171
PflMI	CCANNNNNTGG	1 cut(s)	828
PfoI	TCCNGGA	1 cut(s)	1174
PkrI	GCNGC	2 cut(s)	219, 504
Ple19I	CGATCG	1 cut(s)	1075
PleI	GAGTC	2 cut(s)	951, 1173
PpsI	GAGTC	2 cut(s)	951, 1173
Ppu21I	YACGTR	1 cut(s)	514
PpuMI	RGGWCCY	2 cut(s)	399, 528
PshBI	ATTAAT	2 cut(s)	5, 1087
Psp5II	RGGWCCY	2 cut(s)	399, 528
Psp6I	CCWGG	3 cut(s)	765, 971, 1174
PspGI	CCWGG	3 cut(s)	765, 971, 1174
PspN4I	GGNNCC	4 cut(s)	801, 878, 1105, 1205
PspPI	GGNCC	3 cut(s)	399, 528, 1104
PspPPI	RGGWCCY	2 cut(s)	399, 528
PstNI	CAGNNNCTG	2 cut(s)	55, 547
PsuI	RGATCY	1 cut(s)	87
PvuI	CGATCG	1 cut(s)	1075
RsaI	GTAC	3 cut(s)	512, 764, 801
RsaNI	GTAC	3 cut(s)	511, 763, 800
SaqAI	TTAA	8 cut(s)	5, 293, 523, 589, 716, 1087, 1135, 1151
SatI	GCNGC	2 cut(s)	218, 503
Sau3AI	GATC	4 cut(s)	87, 270, 354, 1072
Sau96I	GGNCC	3 cut(s)	399, 528, 1104
SchI	GAGTC	2 cut(s)	952, 1173
ScrFI	CCNGG	4 cut(s)	767, 973, 1108, 1176
SfaNI	GCATC	5 cut(s)	31, 229, 424, 902, 1129
Sfr274I	CTCGAG	1 cut(s)	617
SinI	GGWCC	3 cut(s)	399, 528, 1104
SlaI	CTCGAG	1 cut(s)	617
SmlI	CTYRAG	1 cut(s)	617
SmoI	CTYRAG	1 cut(s)	617
SnaBI	TACGTA	1 cut(s)	514
Sse9I	AATT	9 cut(s)	39, 136, 859, 871, 1084, 1136, 1147, 1210, 1255
SsiI	CCGC	3 cut(s)	62, 234, 502
SspI	AATATT	1 cut(s)	815
SspMI	CTAG	2 cut(s)	554, 1031
StyD4I	CCNGG	4 cut(s)	765, 971, 1106, 1174
StyI	CCWWGG	1 cut(s)	795
TaaI	ACNGT	1 cut(s)	634
TaiI	ACGT	4 cut(s)	326, 516, 927, 1062
TaqI	TCGA	4 cut(s)	297, 598, 618, 1221
TasI	AATT	9 cut(s)	39, 136, 859, 871, 1084, 1136, 1147, 1210, 1255
TauI	GCSGC	1 cut(s)	505
TfiI	GAWTC	2 cut(s)	432, 1171
Tru1I	TTAA	8 cut(s)	5, 293, 523, 589, 716, 1087, 1135, 1151
Tru9I	TTAA	8 cut(s)	5, 293, 523, 589, 716, 1087, 1135, 1151
TscAI	CASTG	3 cut(s)	51, 349, 963
TseFI	GTSAC	1 cut(s)	165
TseI	GCWGC	1 cut(s)	217
Tsp45I	GTSAC	1 cut(s)	165
TspDTI	ATGAA	5 cut(s)	275, 671, 1097, 1178, 1184
TspRI	CASTG	3 cut(s)	51, 349, 963
Van91I	CCANNNNNTGG	1 cut(s)	828
VpaK11BI	GGWCC	3 cut(s)	399, 528, 1104
VspI	ATTAAT	2 cut(s)	5, 1087
XapI	RAATTY	3 cut(s)	1147, 1210, 1255
XceI	RCATGY	4 cut(s)	304, 509, 970, 1068
XhoI	CTCGAG	1 cut(s)	617
XmnI	GAANNNNTTC	1 cut(s)	431
XspI	CTAG	2 cut(s)	554, 1031
Zsp2I	ATGCAT	1 cut(s)	417

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.