Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002971.1

Orthogroup ID

OG0007778

Physical Location & Seq

Genomic Coordinates Reverse (-)

107609 .. 110407

Gene Structure 2799 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002971.1_g000025.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 594 bp

atgtttggttcatcaagaatttcttcccagaatccaagaaagcagcagcagaagcaagaacgagaatggttaaacttgagttttaagccagagaatttccttccaggagttgtcattggcttcattcttgggttgttgttggatttatcacaacctggtaagggttccttgaagttgaagaggaaaaatttctcagagggtaagccccaacagcgaagtttggtctcgactaatggtgatgaagagcttaaaatggttcttgtagttagacgagacttaaagatgacaactggaaaaatcgcatctcagtgtgctcatgctgccactggcatgtatgcagaactgatgcaaagccataggtcccttttgagacaatgggaggaaaatgggcaacccaaaatagtggttacatgcaagaatcaacaagaaatgaataagctgaaagaagcagctgagggcattggccttccaacttttgttgtcgctgatgcagggcgaacacaggttgtgagtgggtcaaagacggttcttgccgttggaccaggaccaaaggaagtggtagattcagtgacagggaaacagggtctcctctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03013 map03013

Pfam Domains

Protein Families

PTH2

Protein Analysis

197

Amino Acids

21.62

Weight (kDa)

9.79

Isoelectric Point (pI)

38.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007778)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G32900 AT4G32900 AT4G32900 AT4G32900
fragaria_vesca	FvH4_2g35470 FvH4_2g35470
malus_domestica	MD15G1092700.v1.1
prunus_persica	Prupe.1G447600_v2.0.a1 Prupe.1G447600_v2.0.a1 Prupe.1G447600_v2.0.a1 Prupe.1G447600_v2.0.a1 Prupe.1G447600_v2.0.a1 Prupe.1G447600_v2.0.a1 Prupe.1G447600_v2.0.a1
pyrus_communis	pycom15g08590
rosa_chinensis	RchiOBHm_Chr6g0306411
rosa_laevigata	RLG00000010799
rosa_multiflora	Rmu_sc0002971.1_g000025
rosa_roxburghii	Rroxscaffold_7G00161800
rosa_rugosa	Rorug06G0348900 Rorug06G0349000
rosa_samantha	Rh6AG461400 Rh6BG439700
rosa_wichuraiana	Rw6G040210

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	3 cut(s)	18, 94, 187
AfiI	CCNNNNNNNGG	1 cut(s)	161
AgsI	TTSAA	2 cut(s)	172, 178
AjnI	CCWGG	3 cut(s)	103, 154, 541
AluBI	AGCT	3 cut(s)	247, 439, 452
AluI	AGCT	3 cut(s)	247, 439, 452
Alw21I	GWGCWC	1 cut(s)	316
Alw26I	GTCTC	4 cut(s)	229, 267, 364, 590
AoxI	GGCC	1 cut(s)	463
ApeKI	GCWGC	4 cut(s)	43, 46, 320, 449
ApoI	RAATTY	3 cut(s)	18, 94, 187
Asp700I	GAANNNNTTC	2 cut(s)	22, 188
AspS9I	GGNCC	3 cut(s)	360, 539, 545
AsuHPI	GGTGA	1 cut(s)	248
AvaII	GGWCC	3 cut(s)	360, 539, 545
Bbv12I	GWGCWC	1 cut(s)	316
BbvCI	CCTCAGC	1 cut(s)	453
BbvI	GCAGC	4 cut(s)	55, 58, 307, 461
BceAI	ACGGC	1 cut(s)	518
BciT130I	CCWGG	3 cut(s)	105, 156, 543
BcoDI	GTCTC	4 cut(s)	229, 267, 364, 590
BisI	GCNGC	4 cut(s)	44, 47, 321, 450
BlsI	GCNGC	4 cut(s)	45, 48, 322, 451
Bme1390I	CCNGG	3 cut(s)	105, 156, 543
Bme18I	GGWCC	3 cut(s)	360, 539, 545
BmgT120I	GGNCC	3 cut(s)	360, 539, 545
BmiI	GGNNCC	2 cut(s)	166, 362
BmrFI	CCNGG	3 cut(s)	105, 156, 543
BmsI	GCATC	3 cut(s)	311, 336, 478
Bpu10I	CCTNAGC	1 cut(s)	453
BpuEI	CTTGAG	1 cut(s)	97
BsaI	GGTCTC	2 cut(s)	229, 590
BsaXI	ACNNNNNCTCC	1 cut(s)	570
Bsc4I	CCNNNNNNNGG	1 cut(s)	161
Bse1I	ACTGG	2 cut(s)	295, 331
BseBI	CCWGG	3 cut(s)	105, 156, 543
BseLI	CCNNNNNNNGG	1 cut(s)	161
BseMII	CTCAG	3 cut(s)	207, 320, 444
BseNI	ACTGG	2 cut(s)	295, 331
BseRI	GAGGAG	1 cut(s)	578
BseXI	GCAGC	4 cut(s)	55, 58, 307, 461
BshFI	GGCC	1 cut(s)	465
BsiHKAI	GWGCWC	1 cut(s)	316
BslFI	GGGAC	1 cut(s)	346
BslI	CCNNNNNNNGG	1 cut(s)	161
BsmAI	GTCTC	4 cut(s)	229, 267, 364, 590
BsmFI	GGGAC	1 cut(s)	346
BsnI	GGCC	1 cut(s)	465
Bso31I	GGTCTC	2 cut(s)	229, 590
Bsp1286I	GDGCHC	1 cut(s)	316
BspANI	GGCC	1 cut(s)	465
BspCNI	CTCAG	3 cut(s)	206, 319, 445
BspLI	GGNNCC	2 cut(s)	166, 362
BspQI	GCTCTTC	1 cut(s)	237
BspTNI	GGTCTC	2 cut(s)	229, 590
BsrI	ACTGG	2 cut(s)	295, 331
Bst2UI	CCWGG	3 cut(s)	105, 156, 543
Bst4CI	ACNGT	1 cut(s)	526
Bst6I	CTCTTC	2 cut(s)	173, 237
BstDEI	CTNAG	3 cut(s)	193, 306, 453
BstMAI	GTCTC	4 cut(s)	229, 267, 364, 590
BstMWI	GCNNNNNNNGC	3 cut(s)	52, 211, 320
BstNI	CCWGG	3 cut(s)	105, 156, 543
BstNSI	RCATGY	2 cut(s)	334, 414
BstSCI	CCNGG	3 cut(s)	103, 154, 541
BstV1I	GCAGC	4 cut(s)	55, 58, 307, 461
BstXI	CCANNNNNNTGG	1 cut(s)	403
BsuRI	GGCC	1 cut(s)	465
BtsIMutI	CAGTG	3 cut(s)	314, 324, 573
Cfr13I	GGNCC	3 cut(s)	360, 539, 545
CsiI	ACCWGGT	1 cut(s)	154
CspCI	CAANNNNNGTGG	2 cut(s)	537, 572
CviAII	CATG	3 cut(s)	317, 331, 411
CviJI	RGCY	8 cut(s)	88, 120, 205, 247, 354, 439, 452, 465
CviKI_1	RGCY	8 cut(s)	88, 120, 205, 247, 354, 439, 452, 465
DdeI	CTNAG	3 cut(s)	193, 306, 453
Eam1104I	CTCTTC	2 cut(s)	173, 237
EarI	CTCTTC	2 cut(s)	173, 237
Eco31I	GGTCTC	2 cut(s)	229, 590
Eco47I	GGWCC	3 cut(s)	360, 539, 545
EcoO109I	RGGNCCY	1 cut(s)	360
EcoRII	CCWGG	3 cut(s)	103, 154, 541
FaeI	CATG	3 cut(s)	320, 334, 414
FaiI	YATR	5 cut(s)	318, 332, 336, 357, 412
FalI	AAGNNNNNCTT	4 cut(s)	7, 39, 152, 184
FaqI	GGGAC	1 cut(s)	346
FatI	CATG	3 cut(s)	316, 330, 410
Fnu4HI	GCNGC	4 cut(s)	44, 47, 321, 450
Fsp4HI	GCNGC	4 cut(s)	44, 47, 321, 450
GluI	GCNGC	4 cut(s)	44, 47, 321, 450
HaeIII	GGCC	1 cut(s)	465
Hin1II	CATG	3 cut(s)	320, 334, 414
HinfI	GANTC	3 cut(s)	31, 418, 563
HphI	GGTGA	1 cut(s)	248
Hpy188I	TCNGA	2 cut(s)	196, 593
Hpy188III	TCNNGA	2 cut(s)	15, 226
HpyAV	CCTTC	2 cut(s)	110, 476
HpyCH4III	ACNGT	1 cut(s)	526
HpyCH4V	TGCA	4 cut(s)	338, 349, 414, 491
HpyF10VI	GCNNNNNNNGC	3 cut(s)	52, 211, 320
HpyF3I	CTNAG	3 cut(s)	193, 306, 453
Hsp92II	CATG	3 cut(s)	320, 334, 414
LguI	GCTCTTC	1 cut(s)	237
Lsp1109I	GCAGC	4 cut(s)	55, 58, 307, 461
LweI	GCATC	3 cut(s)	311, 336, 478
MabI	ACCWGGT	1 cut(s)	154
MaeIII	GTNAC	2 cut(s)	406, 568
MboII	GAAGA	3 cut(s)	15, 190, 254
MhlI	GDGCHC	1 cut(s)	316
MluCI	AATT	3 cut(s)	18, 94, 187
MmeI	TCCRAC	3 cut(s)	120, 494, 517
MnlI	CCTC	4 cut(s)	174, 190, 373, 448
MroXI	GAANNNNTTC	2 cut(s)	22, 188
MseI	TTAA	4 cut(s)	71, 84, 249, 278
MslI	CAYNNNNRTG	2 cut(s)	307, 329
MspA1I	CMGCKG	1 cut(s)	452
MspR9I	CCNGG	3 cut(s)	105, 156, 543
MvaI	CCWGG	3 cut(s)	105, 156, 543
MwoI	GCNNNNNNNGC	3 cut(s)	52, 211, 320
NlaIII	CATG	3 cut(s)	320, 334, 414
NlaIV	GGNNCC	2 cut(s)	166, 362
NmuCI	GTSAC	1 cut(s)	568
NspI	RCATGY	2 cut(s)	334, 414
PciSI	GCTCTTC	1 cut(s)	237
PdmI	GAANNNNTTC	2 cut(s)	22, 188
PfeI	GAWTC	3 cut(s)	31, 418, 563
PfoI	TCCNGGA	1 cut(s)	103
PkrI	GCNGC	4 cut(s)	45, 48, 322, 451
PpuMI	RGGWCCY	1 cut(s)	360
Psp5II	RGGWCCY	1 cut(s)	360
Psp6I	CCWGG	3 cut(s)	103, 154, 541
PspGI	CCWGG	3 cut(s)	103, 154, 541
PspN4I	GGNNCC	2 cut(s)	166, 362
PspPI	GGNCC	3 cut(s)	360, 539, 545
PspPPI	RGGWCCY	1 cut(s)	360
PvuII	CAGCTG	1 cut(s)	452
RseI	CAYNNNNRTG	2 cut(s)	307, 329
SapI	GCTCTTC	1 cut(s)	237
SaqAI	TTAA	4 cut(s)	71, 84, 249, 278
SatI	GCNGC	4 cut(s)	44, 47, 321, 450
Sau96I	GGNCC	3 cut(s)	360, 539, 545
ScrFI	CCNGG	3 cut(s)	105, 156, 543
SduI	GDGCHC	1 cut(s)	316
SetI	ASST	6 cut(s)	157, 249, 362, 441, 454, 507
SexAI	ACCWGGT	1 cut(s)	154
SfaNI	GCATC	3 cut(s)	311, 336, 478
SinI	GGWCC	3 cut(s)	360, 539, 545
SmiMI	CAYNNNNRTG	2 cut(s)	307, 329
SmlI	CTYRAG	1 cut(s)	76
SmoI	CTYRAG	1 cut(s)	76
Sse9I	AATT	3 cut(s)	18, 94, 187
StyD4I	CCNGG	3 cut(s)	103, 154, 541
TaaI	ACNGT	1 cut(s)	526
TaqI	TCGA	1 cut(s)	227
TasI	AATT	3 cut(s)	18, 94, 187
TfiI	GAWTC	3 cut(s)	31, 418, 563
Tru1I	TTAA	4 cut(s)	71, 84, 249, 278
Tru9I	TTAA	4 cut(s)	71, 84, 249, 278
TscAI	CASTG	3 cut(s)	314, 331, 573
TseFI	GTSAC	1 cut(s)	568
TseI	GCWGC	4 cut(s)	43, 46, 320, 449
Tsp45I	GTSAC	1 cut(s)	568
TspDTI	ATGAA	3 cut(s)	112, 255, 446
TspRI	CASTG	3 cut(s)	314, 331, 573
VpaK11BI	GGWCC	3 cut(s)	360, 539, 545
XapI	RAATTY	3 cut(s)	18, 94, 187
XceI	RCATGY	2 cut(s)	334, 414
XmnI	GAANNNNTTC	2 cut(s)	22, 188

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.