Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003076.1

Orthogroup ID

OG0016252

Physical Location & Seq

Genomic Coordinates Forward (+)

48860 .. 50404

Gene Structure 1545 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003076.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1149 bp

atgaatgatcaagatgttaaacttcagattcttgctggtcttccaagtgagtatggtcatactaggcagattattagagaacaaaaggcgattactatggaggaagtaagatccttacttttatctgctgaatttgaaattgaattaaagcacagctctttacctttgtcaccgcttactgcaatggttagtcacaatgcttcatccattgttaatggtcaccttggtgcttacgaaggtttacttcaaactggggtatcacaagcaccttatacacccaatatagttaatccttgtgctatgtgttttgctgcaataaatcctacttgtaacagttatgttgttggtcaacaaaatggtcatggtgttatgcaacaaagtggtattgggatgcaacaaaatggaggcttttctcaaaatggaaattcttttcaacacaatggtggatttacaaattacattggtggttttaatccagcaaattgcaatcacagcacatatggaggagtttttcaatacaatgatgatggctgcaatttcaaccaaggctctacggataacaatggatactttatcaactttgtatctaatacaccaaatggtatcatggttcatacttctggttcaaatctcgctcattcatatttgactactggtatcccacaacaacttggtagatttcatcactccaatactacttttgcacaacctcaggttagtactgcatatgtcaatcgtactggtggcaatcagtataatggaaatctctctcaacctcacaatggtcacagtgcagcagaatgtttgcgcagacaccactatggttttcaaccacaaacttgcgcagcccctaaagctttgtctgcttccttctgcactcaaccaaagccaccctccattgctactcaaccaaataccaatgcttctcaatcacaagttgtcaagcctctgccatttgcagctccatctccattatcagttcctactcaccctcatttgcagcaaactcttctcaagaaaattgaagttttgtcgacaccaagcacttggctacttccttctactccagacagacatctaatgaagtgtaggcaaacttgtgagccaacaaatttatggcaatcactgccactcattcctcctggttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

382

Amino Acids

41.34

Weight (kDa)

7.67

Isoelectric Point (pI)

42.16

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016252)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g06414 FvH4_6g09731 FvH4_7g15531
rosa_chinensis	RchiOBHm_Chr3g0453851 RchiOBHm_Chr4g0389911 RchiOBHm_Chr5g0017791 RchiOBHm_Chr7g0182071 RchiOBHm_Chr7g0243861
rosa_multiflora	Rmu_sc0000968.1_g000018 Rmu_sc0003076.1_g000010 Rmu_sc0004479.1_g000006 Rmu_sc0012468.1_g000001
rosa_roxburghii	Rroxscaffold_7G00208120
rosa_rugosa	Rorug06G0070100
rosa_samantha	Rh5CG142100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	2 cut(s)	809, 844
AccI	GTMKAC	1 cut(s)	1034
AciI	CCGC	1 cut(s)	173
AclWI	GGATC	1 cut(s)	105
AcsI	RAATTY	3 cut(s)	131, 424, 1111
AcuI	CTGAAG	1 cut(s)	8
AfaI	GTAC	2 cut(s)	721, 739
AfiI	CCNNNNNNNGG	1 cut(s)	782
AgsI	TTSAA	9 cut(s)	137, 143, 248, 434, 515, 541, 627, 830, 1025
AjnI	CCWGG	1 cut(s)	1141
AleI	CACNNNNGTG	2 cut(s)	225, 441
AluBI	AGCT	3 cut(s)	156, 857, 962
AluI	AGCT	3 cut(s)	156, 857, 962
AlwI	GGATC	1 cut(s)	105
ApeKI	GCWGC	6 cut(s)	311, 531, 794, 845, 959, 1000
ApoI	RAATTY	3 cut(s)	131, 424, 1111
AspLEI	GCGC	2 cut(s)	810, 845
AsuHPI	GGTGA	3 cut(s)	162, 212, 980
AxyI	CCTNAGG	1 cut(s)	711
BaeI	ACNNNNGTAYC	2 cut(s)	240, 273
BbsI	GAAGAC	1 cut(s)	32
BbvI	GCAGC	6 cut(s)	298, 518, 806, 857, 971, 1012
BccI	CCATC	2 cut(s)	521, 973
BciT130I	CCWGG	1 cut(s)	1143
BciVI	GTATCC	2 cut(s)	560, 668
BclI	TGATCA	1 cut(s)	7
BfaI	CTAG	1 cut(s)	63
BfuI	GTATCC	2 cut(s)	560, 668
BisI	GCNGC	6 cut(s)	312, 532, 795, 846, 960, 1001
BlsI	GCNGC	6 cut(s)	313, 533, 796, 847, 961, 1002
BmcAI	AGTACT	1 cut(s)	721
Bme1390I	CCNGG	1 cut(s)	1143
BmrFI	CCNGG	1 cut(s)	1143
BmrI	ACTGGG	1 cut(s)	261
BmsI	GCATC	1 cut(s)	381
BmuI	ACTGGG	1 cut(s)	261
BpiI	GAAGAC	1 cut(s)	32
BpmI	CTGGAG	1 cut(s)	1050
BpuEI	CTTGAG	1 cut(s)	998
BsaJI	CCNNGG	2 cut(s)	223, 544
Bsc4I	CCNNNNNNNGG	1 cut(s)	782
Bse1I	ACTGG	3 cut(s)	256, 658, 745
Bse21I	CCTNAGG	1 cut(s)	711
Bse3DI	GCAATG	2 cut(s)	189, 897
BseBI	CCWGG	1 cut(s)	1143
BseDI	CCNNGG	2 cut(s)	223, 544
BseGI	GGATG	2 cut(s)	203, 396
BseLI	CCNNNNNNNGG	1 cut(s)	782
BseMI	GCAATG	2 cut(s)	189, 897
BseMII	CTCAG	1 cut(s)	725
BseNI	ACTGG	3 cut(s)	256, 658, 745
BseRI	GAGGAG	1 cut(s)	519
BseXI	GCAGC	6 cut(s)	298, 518, 806, 857, 971, 1012
BsgI	GTGCAG	2 cut(s)	813, 859
BslI	CCNNNNNNNGG	1 cut(s)	782
Bsp143I	GATC	2 cut(s)	7, 110
BspACI	CCGC	1 cut(s)	173
BspCNI	CTCAG	1 cut(s)	724
BspPI	GGATC	1 cut(s)	105
BsrDI	GCAATG	2 cut(s)	189, 897
BsrI	ACTGG	3 cut(s)	256, 658, 745
BssECI	CCNNGG	2 cut(s)	223, 544
BssMI	GATC	2 cut(s)	7, 110
BssT1I	CCWWGG	2 cut(s)	223, 544
Bst2UI	CCWGG	1 cut(s)	1143
Bst4CI	ACNGT	2 cut(s)	335, 791
Bst6I	CTCTTC	1 cut(s)	1014
BstAPI	GCANNNNNTGC	1 cut(s)	1126
BstDEI	CTNAG	1 cut(s)	711
BstEII	GGTNACC	1 cut(s)	218
BstF5I	GGATG	2 cut(s)	203, 396
BstHHI	GCGC	2 cut(s)	810, 845
BstKTI	GATC	2 cut(s)	10, 113
BstMBI	GATC	2 cut(s)	7, 110
BstMWI	GCNNNNNNNGC	4 cut(s)	492, 854, 863, 1126
BstNI	CCWGG	1 cut(s)	1143
BstPI	GGTNACC	1 cut(s)	218
BstSCI	CCNGG	1 cut(s)	1141
BstV1I	GCAGC	6 cut(s)	298, 518, 806, 857, 971, 1012
BstV2I	GAAGAC	1 cut(s)	32
BstX2I	RGATCY	1 cut(s)	110
BstXI	CCANNNNNNTGG	1 cut(s)	1047
BstYI	RGATCY	1 cut(s)	110
Bsu36I	CCTNAGG	1 cut(s)	711
BsuI	GTATCC	2 cut(s)	560, 668
BtsCI	GGATG	2 cut(s)	203, 396
BtsI	GCAGTG	1 cut(s)	1124
BtsIMutI	CAGTG	2 cut(s)	796, 1124
CfoI	GCGC	2 cut(s)	810, 845
Csp6I	GTAC	2 cut(s)	720, 738
CviAII	CATG	2 cut(s)	362, 607
CviQI	GTAC	2 cut(s)	720, 738
DdeI	CTNAG	1 cut(s)	711
DpnI	GATC	2 cut(s)	9, 112
DpnII	GATC	2 cut(s)	7, 110
Eam1104I	CTCTTC	1 cut(s)	1014
EarI	CTCTTC	1 cut(s)	1014
Eco130I	CCWWGG	2 cut(s)	223, 544
Eco57I	CTGAAG	1 cut(s)	8
Eco81I	CCTNAGG	1 cut(s)	711
Eco91I	GGTNACC	1 cut(s)	218
EcoO65I	GGTNACC	1 cut(s)	218
EcoRII	CCWGG	1 cut(s)	1141
EcoT14I	CCWWGG	2 cut(s)	223, 544
ErhI	CCWWGG	2 cut(s)	223, 544
FaeI	CATG	2 cut(s)	365, 610
FalI	AAGNNNNNCTT	2 cut(s)	228, 260
FatI	CATG	2 cut(s)	361, 606
FauNDI	CATATG	2 cut(s)	499, 727
FbaI	TGATCA	1 cut(s)	7
FblI	GTMKAC	1 cut(s)	1034
Fnu4HI	GCNGC	6 cut(s)	312, 532, 795, 846, 960, 1001
FokI	GGATG	2 cut(s)	190, 403
Fsp4HI	GCNGC	6 cut(s)	312, 532, 795, 846, 960, 1001
FspBI	CTAG	1 cut(s)	63
FspI	TGCGCA	2 cut(s)	809, 844
GlaI	GCGC	2 cut(s)	809, 844
GluI	GCNGC	6 cut(s)	312, 532, 795, 846, 960, 1001
GsuI	CTGGAG	1 cut(s)	1050
HhaI	GCGC	2 cut(s)	810, 845
Hin1II	CATG	2 cut(s)	365, 610
Hin6I	GCGC	2 cut(s)	808, 843
HinP1I	GCGC	2 cut(s)	808, 843
HincII	GTYRAC	2 cut(s)	350, 1035
HindII	GTYRAC	2 cut(s)	350, 1035
HindIII	AAGCTT	1 cut(s)	855
HinfI	GANTC	1 cut(s)	28
HphI	GGTGA	3 cut(s)	162, 212, 980
Hpy166II	GTNNAC	3 cut(s)	242, 350, 1035
Hpy188I	TCNGA	1 cut(s)	27
Hpy188III	TCNNGA	3 cut(s)	11, 1015, 1067
Hpy8I	GTNNAC	3 cut(s)	242, 350, 1035
HpyAV	CCTTC	3 cut(s)	230, 880, 1068
HpyCH4III	ACNGT	2 cut(s)	335, 791
HpyF10VI	GCNNNNNNNGC	4 cut(s)	492, 854, 863, 1126
HpyF3I	CTNAG	1 cut(s)	711
Hsp92II	CATG	2 cut(s)	365, 610
HspAI	GCGC	2 cut(s)	808, 843
Ksp22I	TGATCA	1 cut(s)	7
Kzo9I	GATC	2 cut(s)	7, 110
LmnI	GCTCC	1 cut(s)	967
LpnPI	CCDG	9 cut(s)	21, 237, 489, 606, 639, 698, 726, 1080, 1128
Lsp1109I	GCAGC	6 cut(s)	298, 518, 806, 857, 971, 1012
LweI	GCATC	1 cut(s)	381
MaeI	CTAG	1 cut(s)	63
MaeIII	GTNAC	5 cut(s)	168, 191, 218, 329, 785
MalI	GATC	2 cut(s)	9, 112
MboI	GATC	2 cut(s)	7, 110
MboII	GAAGA	2 cut(s)	32, 1001
MflI	RGATCY	1 cut(s)	110
MluCI	AATT	9 cut(s)	131, 138, 143, 424, 454, 481, 535, 1020, 1111
MnlI	CCTC	9 cut(s)	94, 398, 497, 720, 786, 904, 957, 1002, 1149
MseI	TTAA	5 cut(s)	18, 146, 213, 288, 471
MslI	CAYNNNNRTG	3 cut(s)	225, 441, 819
MspR9I	CCNGG	1 cut(s)	1143
MvaI	CCWGG	1 cut(s)	1143
MwoI	GCNNNNNNNGC	4 cut(s)	492, 854, 863, 1126
NdeI	CATATG	2 cut(s)	499, 727
NdeII	GATC	2 cut(s)	7, 110
NlaIII	CATG	2 cut(s)	365, 610
NmuCI	GTSAC	4 cut(s)	168, 191, 218, 785
NsbI	TGCGCA	2 cut(s)	809, 844
OliI	CACNNNNGTG	2 cut(s)	225, 441
PfeI	GAWTC	1 cut(s)	28
PkrI	GCNGC	6 cut(s)	313, 533, 796, 847, 961, 1002
Psp6I	CCWGG	1 cut(s)	1141
PspEI	GGTNACC	1 cut(s)	218
PspGI	CCWGG	1 cut(s)	1141
PsuI	RGATCY	1 cut(s)	110
RsaI	GTAC	2 cut(s)	721, 739
RsaNI	GTAC	2 cut(s)	720, 738
RseI	CAYNNNNRTG	3 cut(s)	225, 441, 819
SalI	GTCGAC	1 cut(s)	1033
SaqAI	TTAA	5 cut(s)	18, 146, 213, 288, 471
SatI	GCNGC	6 cut(s)	312, 532, 795, 846, 960, 1001
Sau3AI	GATC	2 cut(s)	7, 110
ScaI	AGTACT	1 cut(s)	721
ScrFI	CCNGG	1 cut(s)	1143
SfaNI	GCATC	1 cut(s)	381
SmiMI	CAYNNNNRTG	3 cut(s)	225, 441, 819
SmlI	CTYRAG	1 cut(s)	1013
SmoI	CTYRAG	1 cut(s)	1013
Sse9I	AATT	9 cut(s)	131, 138, 143, 424, 454, 481, 535, 1020, 1111
SsiI	CCGC	1 cut(s)	173
SspMI	CTAG	1 cut(s)	63
StyD4I	CCNGG	1 cut(s)	1141
StyI	CCWWGG	2 cut(s)	223, 544
TaaI	ACNGT	2 cut(s)	335, 791
TaqI	TCGA	1 cut(s)	1034
TasI	AATT	9 cut(s)	131, 138, 143, 424, 454, 481, 535, 1020, 1111
TatI	WGTACW	1 cut(s)	719
TfiI	GAWTC	1 cut(s)	28
Tru1I	TTAA	5 cut(s)	18, 146, 213, 288, 471
Tru9I	TTAA	5 cut(s)	18, 146, 213, 288, 471
TscAI	CASTG	2 cut(s)	796, 1131
TseFI	GTSAC	4 cut(s)	168, 191, 218, 785
TseI	GCWGC	6 cut(s)	311, 531, 794, 845, 959, 1000
Tsp45I	GTSAC	4 cut(s)	168, 191, 218, 785
TspDTI	ATGAA	6 cut(s)	17, 192, 602, 630, 671, 1097
TspGWI	ACGGA	1 cut(s)	569
TspRI	CASTG	2 cut(s)	796, 1131
XapI	RAATTY	3 cut(s)	131, 424, 1111
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1113
XmiI	GTMKAC	1 cut(s)	1034
XspI	CTAG	1 cut(s)	63
ZrmI	AGTACT	1 cut(s)	721

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.