Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003392.1

Orthogroup ID

OG0007824

Physical Location & Seq

Genomic Coordinates Forward (+)

18295 .. 19184

Gene Structure 890 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003392.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 324 bp

atggtagtgtcgactgccttacatggtgcttttagcactagtagcctgcaaagagcggttaatactggtgtgactgaggctaggggaaggatattcgggcatgtgcttaacccgacaggcctgaagtctgcgcataagattttgcgcaagaagctgattggggagaatgttgcccagtggtacccacacgacatcaggaaagatgacccccttatcatggaagctgaggaaaaagagcgcacaaacaagcttgaaatgttgaagcgccgaggaaaaggaccacccaagaagggtcaaggaaaacgttccaagcgcaagagctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MRP-S33

Protein Analysis

107

Amino Acids

12.0

Weight (kDa)

10.7

Isoelectric Point (pI)

32.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007824)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G44710
fragaria_vesca	FvH4_3g13100
malus_domestica	MD05G1245000.v1.1 MD10G1226300.v1.1
prunus_persica	Prupe.1G101300_v2.0.a1
pyrus_communis	pycom10g19020
rosa_chinensis	RchiOBHm_Chr3g0492041 RchiOBHm_Chr5g0021361
rosa_laevigata	RLG00000022798 RLG00000032606
rosa_multiflora	Rmu_sc0003392.1_g000005 Rmu_sc0005238.1_g000002 Rmu_sc0043047.1_g000001
rosa_roxburghii	Rroxscaffold_1G00057170 Rroxscaffold_6G00392610
rosa_rugosa	Rorug03G0251400
rosa_samantha	Rh3AG301600 Rh3DG336900 Rh5AG155700 Rh5BG155200 Rh5CG168900 Rh5DG155700
rosa_wichuraiana	Rw3G026620 Rw5G013870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	2 cut(s)	132, 146
Acc65I	GGTACC	1 cut(s)	180
AccB1I	GGYRCC	1 cut(s)	180
AccBSI	CCGCTC	1 cut(s)	56
AccI	GTMKAC	1 cut(s)	11
AciI	CCGC	1 cut(s)	56
AclI	AACGTT	1 cut(s)	304
AcuI	CTGAAG	1 cut(s)	143
AfaI	GTAC	1 cut(s)	182
AfiI	CCNNNNNNNGG	2 cut(s)	217, 290
AgsI	TTSAA	2 cut(s)	254, 262
AhlI	ACTAGT	1 cut(s)	38
AluBI	AGCT	4 cut(s)	154, 224, 250, 321
AluI	AGCT	4 cut(s)	154, 224, 250, 321
AoxI	GGCC	1 cut(s)	118
Asp700I	GAANNNNTTC	1 cut(s)	304
Asp718I	GGTACC	1 cut(s)	180
AspLEI	GCGC	5 cut(s)	133, 147, 240, 267, 315
AspS9I	GGNCC	1 cut(s)	278
AvaII	GGWCC	1 cut(s)	278
BanI	GGYRCC	1 cut(s)	180
BbvCI	CCTCAGC	1 cut(s)	225
BcuI	ACTAGT	1 cut(s)	38
BfaI	CTAG	3 cut(s)	39, 81, 322
BfoI	RGCGCY	1 cut(s)	268
Bme18I	GGWCC	1 cut(s)	278
BmgT120I	GGNCC	1 cut(s)	278
BmiI	GGNNCC	1 cut(s)	182
BmrI	ACTGGG	1 cut(s)	169
BmuI	ACTGGG	1 cut(s)	169
Bpu10I	CCTNAGC	1 cut(s)	225
BsaJI	CCNNGG	1 cut(s)	268
Bsc4I	CCNNNNNNNGG	2 cut(s)	217, 290
Bse1I	ACTGG	2 cut(s)	70, 175
BseDI	CCNNGG	1 cut(s)	268
BseLI	CCNNNNNNNGG	2 cut(s)	217, 290
BseMII	CTCAG	2 cut(s)	66, 216
BseNI	ACTGG	2 cut(s)	70, 175
BshFI	GGCC	1 cut(s)	120
BshNI	GGYRCC	1 cut(s)	180
BslI	CCNNNNNNNGG	2 cut(s)	217, 290
BsnI	GGCC	1 cut(s)	120
BspACI	CCGC	1 cut(s)	56
BspANI	GGCC	1 cut(s)	120
BspCNI	CTCAG	2 cut(s)	67, 217
BspLI	GGNNCC	1 cut(s)	182
BspT107I	GGYRCC	1 cut(s)	180
BsrBI	CCGCTC	1 cut(s)	56
BsrI	ACTGG	2 cut(s)	70, 175
BssECI	CCNNGG	1 cut(s)	268
BstC8I	GCNNGC	1 cut(s)	47
BstDEI	CTNAG	2 cut(s)	75, 225
BstH2I	RGCGCY	1 cut(s)	268
BstHHI	GCGC	5 cut(s)	133, 147, 240, 267, 315
BstMWI	GCNNNNNNNGC	2 cut(s)	42, 151
BstNSI	RCATGY	1 cut(s)	104
BsuRI	GGCC	1 cut(s)	120
BtsIMutI	CAGTG	1 cut(s)	182
Cac8I	GCNNGC	1 cut(s)	47
CfoI	GCGC	5 cut(s)	133, 147, 240, 267, 315
Cfr13I	GGNCC	1 cut(s)	278
Csp6I	GTAC	1 cut(s)	181
CviAII	CATG	3 cut(s)	23, 101, 217
CviJI	RGCY	7 cut(s)	45, 80, 120, 154, 224, 250, 321
CviKI_1	RGCY	7 cut(s)	45, 80, 120, 154, 224, 250, 321
CviQI	GTAC	1 cut(s)	181
DdeI	CTNAG	2 cut(s)	75, 225
Eco147I	AGGCCT	1 cut(s)	120
Eco47I	GGWCC	1 cut(s)	278
Eco57I	CTGAAG	1 cut(s)	143
FaeI	CATG	3 cut(s)	26, 104, 220
FaiI	YATR	4 cut(s)	24, 102, 135, 218
FatI	CATG	3 cut(s)	22, 100, 216
FblI	GTMKAC	1 cut(s)	11
FspBI	CTAG	3 cut(s)	39, 81, 322
FspI	TGCGCA	2 cut(s)	132, 146
GlaI	GCGC	5 cut(s)	132, 146, 239, 266, 314
HaeII	RGCGCY	1 cut(s)	268
HaeIII	GGCC	1 cut(s)	120
HhaI	GCGC	5 cut(s)	133, 147, 240, 267, 315
Hin1II	CATG	3 cut(s)	26, 104, 220
Hin6I	GCGC	5 cut(s)	131, 145, 238, 265, 313
HinP1I	GCGC	5 cut(s)	131, 145, 238, 265, 313
HincII	GTYRAC	1 cut(s)	12
HindII	GTYRAC	1 cut(s)	12
HindIII	AAGCTT	1 cut(s)	248
Hpy166II	GTNNAC	1 cut(s)	12
Hpy188III	TCNNGA	1 cut(s)	196
Hpy8I	GTNNAC	1 cut(s)	12
HpyAV	CCTTC	2 cut(s)	81, 283
HpyCH4IV	ACGT	1 cut(s)	304
HpyCH4V	TGCA	1 cut(s)	49
HpyF10VI	GCNNNNNNNGC	2 cut(s)	42, 151
HpyF3I	CTNAG	2 cut(s)	75, 225
HpySE526I	ACGT	1 cut(s)	304
Hsp92II	CATG	3 cut(s)	26, 104, 220
HspAI	GCGC	5 cut(s)	131, 145, 238, 265, 313
KpnI	GGTACC	1 cut(s)	184
LpnPI	CCDG	6 cut(s)	51, 59, 102, 134, 181, 188
MaeI	CTAG	3 cut(s)	39, 81, 322
MaeII	ACGT	1 cut(s)	304
MaeIII	GTNAC	1 cut(s)	70
MbiI	CCGCTC	1 cut(s)	56
MnlI	CCTC	3 cut(s)	70, 220, 263
MroXI	GAANNNNTTC	1 cut(s)	304
MseI	TTAA	2 cut(s)	60, 108
MwoI	GCNNNNNNNGC	2 cut(s)	42, 151
NlaIII	CATG	3 cut(s)	26, 104, 220
NlaIV	GGNNCC	1 cut(s)	182
NmeAIII	GCCGAG	1 cut(s)	293
NmuCI	GTSAC	1 cut(s)	70
NsbI	TGCGCA	2 cut(s)	132, 146
NspI	RCATGY	1 cut(s)	104
PceI	AGGCCT	1 cut(s)	120
PdmI	GAANNNNTTC	1 cut(s)	304
Psp1406I	AACGTT	1 cut(s)	304
PspN4I	GGNNCC	1 cut(s)	182
PspPI	GGNCC	1 cut(s)	278
RsaI	GTAC	1 cut(s)	182
RsaNI	GTAC	1 cut(s)	181
SalI	GTCGAC	1 cut(s)	10
SaqAI	TTAA	2 cut(s)	60, 108
Sau96I	GGNCC	1 cut(s)	278
SetI	ASST	5 cut(s)	156, 226, 252, 307, 323
SinI	GGWCC	1 cut(s)	278
SpeI	ACTAGT	1 cut(s)	38
SseBI	AGGCCT	1 cut(s)	120
SsiI	CCGC	1 cut(s)	56
SspMI	CTAG	3 cut(s)	39, 81, 322
StuI	AGGCCT	1 cut(s)	120
TaiI	ACGT	1 cut(s)	307
TaqI	TCGA	1 cut(s)	11
Tru1I	TTAA	2 cut(s)	60, 108
Tru9I	TTAA	2 cut(s)	60, 108
TscAI	CASTG	1 cut(s)	182
TseFI	GTSAC	1 cut(s)	70
Tsp45I	GTSAC	1 cut(s)	70
TspRI	CASTG	1 cut(s)	182
VpaK11BI	GGWCC	1 cut(s)	278
XceI	RCATGY	1 cut(s)	104
XmiI	GTMKAC	1 cut(s)	11
XmnI	GAANNNNTTC	1 cut(s)	304
XspI	CTAG	3 cut(s)	39, 81, 322

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.