Rh5BG155200

Mitochondrial ribosomal subunit S27

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0007824
Physical Location & Seq
Reverse (-)
15877706 .. 15878970
1265 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG155200.1

Sequence Viewer

Length: 306 bp
ATGGCGCCTGGCAGTTTAAAGAGCATTTTGACTGCGGCGGTTAATACTGGGGTGACTGAGGCTAGGGCAAGGATATTCGGGCATGTGCTTAACCCGACAGGCCTGAAGTCTGCGCATAAGATTTTGCGCAAGAAGCTGATTGGGGAGAAAGTTGCCCAGTGGTACCCACACGACATCAGGAAAGATGACCCCCTTATCATGGAAGCTGAGGAAAAAGAGCGCACAAACAAGCTTGAAATGTTGAAGCGTCGAGGAAAAGGACCACCCAAGAAGGGTCAAGGAAAACGTTCCAAGCGCAAGAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MRP-S33

Protein Analysis

101

Amino Acids

11.32

Weight (kDa)

10.61

Isoelectric Point (pI)

34.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MRP-S33 PF08293 18 - 91 3.5e-15 Mitochondrial ribosomal subunit S27
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 2 cut(s) 114, 128
Acc65I GGTACC 1 cut(s) 162
AccB1I GGYRCC 2 cut(s) 4, 162
AciI CCGC 2 cut(s) 35, 38
AclI AACGTT 1 cut(s) 286
AcuI CTGAAG 1 cut(s) 125
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 1 cut(s) 164
AfiI CCNNNNNNNGG 2 cut(s) 199, 272
AgsI TTSAA 2 cut(s) 236, 244
AjnI CCWGG 1 cut(s) 7
AluBI AGCT 4 cut(s) 136, 206, 232, 303
AluI AGCT 4 cut(s) 136, 206, 232, 303
AoxI GGCC 1 cut(s) 100
Asp700I GAANNNNTTC 1 cut(s) 286
Asp718I GGTACC 1 cut(s) 162
AspLEI GCGC 5 cut(s) 7, 115, 129, 222, 297
AspS9I GGNCC 1 cut(s) 260
AsuHPI GGTGA 1 cut(s) 64
AvaII GGWCC 1 cut(s) 260
BanI GGYRCC 2 cut(s) 4, 162
BbvCI CCTCAGC 1 cut(s) 207
BciT130I CCWGG 1 cut(s) 9
BfaI CTAG 2 cut(s) 63, 304
BfoI RGCGCY 1 cut(s) 8
BisI GCNGC 1 cut(s) 36
BlsI GCNGC 1 cut(s) 37
Bme1390I CCNGG 1 cut(s) 9
Bme18I GGWCC 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 260
BmiI GGNNCC 2 cut(s) 6, 164
BmrFI CCNGG 1 cut(s) 9
BmrI ACTGGG 2 cut(s) 57, 151
BmuI ACTGGG 2 cut(s) 57, 151
Bpu10I CCTNAGC 1 cut(s) 207
BsaHI GRCGYC 1 cut(s) 5
Bsc4I CCNNNNNNNGG 2 cut(s) 199, 272
Bse1I ACTGG 2 cut(s) 52, 157
BseBI CCWGG 1 cut(s) 9
BseLI CCNNNNNNNGG 2 cut(s) 199, 272
BseMII CTCAG 2 cut(s) 48, 198
BseNI ACTGG 2 cut(s) 52, 157
BshFI GGCC 1 cut(s) 102
BshNI GGYRCC 2 cut(s) 4, 162
BslI CCNNNNNNNGG 2 cut(s) 199, 272
BsnI GGCC 1 cut(s) 102
BspACI CCGC 2 cut(s) 35, 38
BspANI GGCC 1 cut(s) 102
BspCNI CTCAG 2 cut(s) 49, 199
BspLI GGNNCC 2 cut(s) 6, 164
BspT107I GGYRCC 2 cut(s) 4, 162
BsrI ACTGG 2 cut(s) 52, 157
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 9
BstACI GRCGYC 1 cut(s) 5
BstDEI CTNAG 2 cut(s) 57, 207
BstH2I RGCGCY 1 cut(s) 8
BstHHI GCGC 5 cut(s) 7, 115, 129, 222, 297
BstMWI GCNNNNNNNGC 1 cut(s) 133
BstNI CCWGG 1 cut(s) 9
BstNSI RCATGY 1 cut(s) 86
BstSCI CCNGG 1 cut(s) 7
BsuRI GGCC 1 cut(s) 102
BtsIMutI CAGTG 1 cut(s) 164
CfoI GCGC 5 cut(s) 7, 115, 129, 222, 297
Cfr13I GGNCC 1 cut(s) 260
CseI GACGC 1 cut(s) 236
Csp6I GTAC 1 cut(s) 163
CviAII CATG 2 cut(s) 83, 199
CviJI RGCY 6 cut(s) 62, 102, 136, 206, 232, 303
CviKI_1 RGCY 6 cut(s) 62, 102, 136, 206, 232, 303
CviQI GTAC 1 cut(s) 163
DdeI CTNAG 2 cut(s) 57, 207
DinI GGCGCC 1 cut(s) 6
DraI TTTAAA 1 cut(s) 18
Eco147I AGGCCT 1 cut(s) 102
Eco47I GGWCC 1 cut(s) 260
Eco57I CTGAAG 1 cut(s) 125
EcoRII CCWGG 1 cut(s) 7
EgeI GGCGCC 1 cut(s) 6
EheI GGCGCC 1 cut(s) 6
FaeI CATG 2 cut(s) 86, 202
FaiI YATR 3 cut(s) 84, 117, 200
FatI CATG 2 cut(s) 82, 198
Fnu4HI GCNGC 1 cut(s) 36
Fsp4HI GCNGC 1 cut(s) 36
FspBI CTAG 2 cut(s) 63, 304
FspI TGCGCA 2 cut(s) 114, 128
GlaI GCGC 5 cut(s) 6, 114, 128, 221, 296
GluI GCNGC 1 cut(s) 36
HaeII RGCGCY 1 cut(s) 8
HaeIII GGCC 1 cut(s) 102
HgaI GACGC 1 cut(s) 236
HhaI GCGC 5 cut(s) 7, 115, 129, 222, 297
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 2 cut(s) 86, 202
Hin6I GCGC 5 cut(s) 5, 113, 127, 220, 295
HinP1I GCGC 5 cut(s) 5, 113, 127, 220, 295
HindIII AAGCTT 1 cut(s) 230
HphI GGTGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 178
Hpy99I CGWCG 1 cut(s) 252
HpyAV CCTTC 1 cut(s) 265
HpyCH4IV ACGT 1 cut(s) 286
HpyF10VI GCNNNNNNNGC 1 cut(s) 133
HpyF3I CTNAG 2 cut(s) 57, 207
HpySE526I ACGT 1 cut(s) 286
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 2 cut(s) 86, 202
HspAI GCGC 5 cut(s) 5, 113, 127, 220, 295
KasI GGCGCC 1 cut(s) 4
KpnI GGTACC 1 cut(s) 166
LpnPI CCDG 6 cut(s) 21, 33, 84, 116, 163, 170
MaeI CTAG 2 cut(s) 63, 304
MaeII ACGT 1 cut(s) 286
MaeIII GTNAC 1 cut(s) 52
Mly113I GGCGCC 1 cut(s) 5
MnlI CCTC 3 cut(s) 52, 202, 245
MroXI GAANNNNTTC 1 cut(s) 286
MseI TTAA 3 cut(s) 17, 42, 90
MspR9I CCNGG 1 cut(s) 9
MvaI CCWGG 1 cut(s) 9
MwoI GCNNNNNNNGC 1 cut(s) 133
NarI GGCGCC 1 cut(s) 5
NlaIII CATG 2 cut(s) 86, 202
NlaIV GGNNCC 2 cut(s) 6, 164
NmuCI GTSAC 1 cut(s) 52
NsbI TGCGCA 2 cut(s) 114, 128
NspI RCATGY 1 cut(s) 86
PceI AGGCCT 1 cut(s) 102
PdmI GAANNNNTTC 1 cut(s) 286
PkrI GCNGC 1 cut(s) 37
PluTI GGCGCC 1 cut(s) 8
Psp1406I AACGTT 1 cut(s) 286
Psp6I CCWGG 1 cut(s) 7
PspGI CCWGG 1 cut(s) 7
PspN4I GGNNCC 2 cut(s) 6, 164
PspPI GGNCC 1 cut(s) 260
RsaI GTAC 1 cut(s) 164
RsaNI GTAC 1 cut(s) 163
SaqAI TTAA 3 cut(s) 17, 42, 90
SatI GCNGC 1 cut(s) 36
Sau96I GGNCC 1 cut(s) 260
ScrFI CCNGG 1 cut(s) 9
SetI ASST 5 cut(s) 138, 208, 234, 289, 305
SfoI GGCGCC 1 cut(s) 6
SinI GGWCC 1 cut(s) 260
SseBI AGGCCT 1 cut(s) 102
SsiI CCGC 2 cut(s) 35, 38
SspDI GGCGCC 1 cut(s) 4
SspMI CTAG 2 cut(s) 63, 304
StuI AGGCCT 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 7
TaiI ACGT 1 cut(s) 289
TaqI TCGA 1 cut(s) 250
TauI GCSGC 1 cut(s) 38
Tru1I TTAA 3 cut(s) 17, 42, 90
Tru9I TTAA 3 cut(s) 17, 42, 90
TscAI CASTG 1 cut(s) 164
TseFI GTSAC 1 cut(s) 52
Tsp45I GTSAC 1 cut(s) 52
TspRI CASTG 1 cut(s) 164
VpaK11BI GGWCC 1 cut(s) 260
XceI RCATGY 1 cut(s) 86
XmnI GAANNNNTTC 1 cut(s) 286
XspI CTAG 2 cut(s) 63, 304
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.