Rroxscaffold_6G00392610

Mitochondrial ribosomal subunit S27

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
12227018 .. 12230344
3327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00392610.1

Sequence Viewer

Length: 306 bp
ATGGCATCTGGCAGTCTAAAGAGCATTTTGACTGCGGCTGTTAATACTGGGGTGACTGAGGCTAGGGCAAGGATATTCGGGCATGTGCTTAACCCGACAGGCTTGAAGTCTGCGCATAAGATTTTGCGCAAGAAGCTGATTGGGGAGAAAGTTGCCCAGTGGTACCCACATGACATCAGGAAAGATGACCCCCTTATCATGGAAGCTGAGGAAAAAGAGCGCACAAACAAGCTTGAAATGTTGAAGCGTCGAGGAAAAGGACCACCCAAGAAGGGTCAAGGAAAGCGTTCCAAGCGCAAGAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.31

Weight (kDa)

10.61

Isoelectric Point (pI)

32.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MRP-S33 PF08293 18 - 91 3.5e-15 Mitochondrial ribosomal subunit S27
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 2 cut(s) 114, 128
Acc65I GGTACC 1 cut(s) 162
AccB1I GGYRCC 1 cut(s) 162
AciI CCGC 1 cut(s) 35
AfaI GTAC 1 cut(s) 164
AfiI CCNNNNNNNGG 2 cut(s) 199, 272
AgsI TTSAA 3 cut(s) 106, 236, 244
AluBI AGCT 4 cut(s) 136, 206, 232, 303
AluI AGCT 4 cut(s) 136, 206, 232, 303
Asp700I GAANNNNTTC 1 cut(s) 286
Asp718I GGTACC 1 cut(s) 162
AspLEI GCGC 4 cut(s) 115, 129, 222, 297
AspS9I GGNCC 1 cut(s) 260
AsuHPI GGTGA 1 cut(s) 64
AvaII GGWCC 1 cut(s) 260
BanI GGYRCC 1 cut(s) 162
BbvCI CCTCAGC 1 cut(s) 207
BfaI CTAG 2 cut(s) 63, 304
BisI GCNGC 1 cut(s) 36
BlsI GCNGC 1 cut(s) 37
Bme18I GGWCC 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 260
BmiI GGNNCC 1 cut(s) 164
BmrI ACTGGG 2 cut(s) 57, 151
BmsI GCATC 1 cut(s) 14
BmuI ACTGGG 2 cut(s) 57, 151
Bpu10I CCTNAGC 1 cut(s) 207
Bsc4I CCNNNNNNNGG 2 cut(s) 199, 272
Bse1I ACTGG 2 cut(s) 52, 157
BseLI CCNNNNNNNGG 2 cut(s) 199, 272
BseMII CTCAG 2 cut(s) 48, 198
BseNI ACTGG 2 cut(s) 52, 157
BshNI GGYRCC 1 cut(s) 162
BslI CCNNNNNNNGG 2 cut(s) 199, 272
BspACI CCGC 1 cut(s) 35
BspCNI CTCAG 2 cut(s) 49, 199
BspLI GGNNCC 1 cut(s) 164
BspT107I GGYRCC 1 cut(s) 162
BsrI ACTGG 2 cut(s) 52, 157
BstDEI CTNAG 2 cut(s) 57, 207
BstHHI GCGC 4 cut(s) 115, 129, 222, 297
BstMWI GCNNNNNNNGC 2 cut(s) 133, 292
BstNSI RCATGY 1 cut(s) 86
BtsIMutI CAGTG 1 cut(s) 164
CfoI GCGC 4 cut(s) 115, 129, 222, 297
Cfr13I GGNCC 1 cut(s) 260
CseI GACGC 1 cut(s) 236
Csp6I GTAC 1 cut(s) 163
CviAII CATG 3 cut(s) 83, 170, 199
CviJI RGCY 7 cut(s) 38, 62, 102, 136, 206, 232, 303
CviKI_1 RGCY 7 cut(s) 38, 62, 102, 136, 206, 232, 303
CviQI GTAC 1 cut(s) 163
DdeI CTNAG 2 cut(s) 57, 207
Eco47I GGWCC 1 cut(s) 260
FaeI CATG 3 cut(s) 86, 173, 202
FaiI YATR 4 cut(s) 84, 117, 171, 200
FatI CATG 3 cut(s) 82, 169, 198
Fnu4HI GCNGC 1 cut(s) 36
Fsp4HI GCNGC 1 cut(s) 36
FspBI CTAG 2 cut(s) 63, 304
FspI TGCGCA 2 cut(s) 114, 128
GlaI GCGC 4 cut(s) 114, 128, 221, 296
GluI GCNGC 1 cut(s) 36
HgaI GACGC 1 cut(s) 236
HhaI GCGC 4 cut(s) 115, 129, 222, 297
Hin1II CATG 3 cut(s) 86, 173, 202
Hin6I GCGC 4 cut(s) 113, 127, 220, 295
HinP1I GCGC 4 cut(s) 113, 127, 220, 295
HindIII AAGCTT 1 cut(s) 230
HphI GGTGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 178
Hpy99I CGWCG 1 cut(s) 252
HpyAV CCTTC 1 cut(s) 265
HpyF10VI GCNNNNNNNGC 2 cut(s) 133, 292
HpyF3I CTNAG 2 cut(s) 57, 207
Hsp92II CATG 3 cut(s) 86, 173, 202
HspAI GCGC 4 cut(s) 113, 127, 220, 295
KpnI GGTACC 1 cut(s) 166
LpnPI CCDG 4 cut(s) 33, 84, 163, 170
LweI GCATC 1 cut(s) 14
MaeI CTAG 2 cut(s) 63, 304
MaeIII GTNAC 1 cut(s) 52
MnlI CCTC 3 cut(s) 52, 202, 245
MroXI GAANNNNTTC 1 cut(s) 286
MseI TTAA 2 cut(s) 42, 90
MwoI GCNNNNNNNGC 2 cut(s) 133, 292
NlaIII CATG 3 cut(s) 86, 173, 202
NlaIV GGNNCC 1 cut(s) 164
NmuCI GTSAC 1 cut(s) 52
NsbI TGCGCA 2 cut(s) 114, 128
NspI RCATGY 1 cut(s) 86
PdmI GAANNNNTTC 1 cut(s) 286
PkrI GCNGC 1 cut(s) 37
PspN4I GGNNCC 1 cut(s) 164
PspPI GGNCC 1 cut(s) 260
RsaI GTAC 1 cut(s) 164
RsaNI GTAC 1 cut(s) 163
SaqAI TTAA 2 cut(s) 42, 90
SatI GCNGC 1 cut(s) 36
Sau96I GGNCC 1 cut(s) 260
SetI ASST 4 cut(s) 138, 208, 234, 305
SfaNI GCATC 1 cut(s) 14
SinI GGWCC 1 cut(s) 260
SsiI CCGC 1 cut(s) 35
SspMI CTAG 2 cut(s) 63, 304
TaqI TCGA 1 cut(s) 250
TauI GCSGC 1 cut(s) 38
Tru1I TTAA 2 cut(s) 42, 90
Tru9I TTAA 2 cut(s) 42, 90
TscAI CASTG 1 cut(s) 164
TseFI GTSAC 1 cut(s) 52
Tsp45I GTSAC 1 cut(s) 52
TspRI CASTG 1 cut(s) 164
VpaK11BI GGWCC 1 cut(s) 260
XceI RCATGY 1 cut(s) 86
XmnI GAANNNNTTC 1 cut(s) 286
XspI CTAG 2 cut(s) 63, 304
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.