Rmu_sc0003419.1_g000040

F-box LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003419.1
OG0008756
Physical Location & Seq
Reverse (-)
136373 .. 137439
1067 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003419.1_g000040.1.cds

Sequence Viewer

Length: 387 bp
atgattcactgtctgattttggcagattatgctatgcccgaggaaactgtcatcgtgggtgatgagaagggtcggtttttgtatagaagtgagaatgagtctagaaatgtctgtgggactgcaacatccttttcagttgctgttgctcttatatttgccagggacaaagaaaactcctgtggtataggggatattcaattccaaattgcattgtcagaaggtgtgtcaacagtaggtcccaaacacaaggctgtctctgttagagctagcgcctctgattctacttggctcactgctagaagagaaggacaccgcgagattcttgatggtcaacgaattctgaatgatattaacgatgaggtaataaaattacatttaacattctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FIST FIST_C

Protein Analysis

128

Amino Acids

14.12

Weight (kDa)

5.52

Isoelectric Point (pI)

40.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 315
AciI CCGC 1 cut(s) 313
AcsI RAATTY 1 cut(s) 336
AgsI TTSAA 1 cut(s) 197
AjnI CCWGG 1 cut(s) 158
AluBI AGCT 1 cut(s) 266
AluI AGCT 1 cut(s) 266
Alw26I GTCTC 1 cut(s) 259
AlwNI CAGNNNCTG 1 cut(s) 140
Ama87I CYCGRG 1 cut(s) 38
ApoI RAATTY 1 cut(s) 336
AspLEI GCGC 1 cut(s) 272
AspS9I GGNCC 1 cut(s) 236
AsuHPI GGTGA 1 cut(s) 71
AsuNHI GCTAGC 1 cut(s) 266
AvaI CYCGRG 1 cut(s) 38
AvaII GGWCC 1 cut(s) 236
BccI CCATC 1 cut(s) 320
BciT130I CCWGG 1 cut(s) 160
BcoDI GTCTC 1 cut(s) 259
BfaI CTAG 3 cut(s) 102, 267, 297
BfoI RGCGCY 1 cut(s) 273
Bme1390I CCNGG 1 cut(s) 160
Bme18I GGWCC 1 cut(s) 236
BmeT110I CYCGRG 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 236
BmiI GGNNCC 1 cut(s) 238
BmrFI CCNGG 1 cut(s) 160
BmtI GCTAGC 1 cut(s) 270
BsaJI CCNNGG 2 cut(s) 39, 159
BseBI CCWGG 1 cut(s) 160
BseDI CCNNGG 2 cut(s) 39, 159
BseGI GGATG 1 cut(s) 125
Bsh1236I CGCG 1 cut(s) 315
BsiHKCI CYCGRG 1 cut(s) 38
BslFI GGGAC 3 cut(s) 130, 176, 222
BsmAI GTCTC 1 cut(s) 259
BsmFI GGGAC 3 cut(s) 130, 176, 222
BsoBI CYCGRG 1 cut(s) 38
BspACI CCGC 1 cut(s) 313
BspFNI CGCG 1 cut(s) 315
BspLI GGNNCC 1 cut(s) 238
BspOI GCTAGC 1 cut(s) 270
BssECI CCNNGG 2 cut(s) 39, 159
Bst2UI CCWGG 1 cut(s) 160
Bst4CI ACNGT 3 cut(s) 11, 49, 232
Bst6I CTCTTC 1 cut(s) 295
BstAPI GCANNNNNTGC 1 cut(s) 29
BstC8I GCNNGC 1 cut(s) 268
BstF5I GGATG 1 cut(s) 125
BstFNI CGCG 1 cut(s) 315
BstH2I RGCGCY 1 cut(s) 273
BstHHI GCGC 1 cut(s) 272
BstMAI GTCTC 1 cut(s) 259
BstMWI GCNNNNNNNGC 1 cut(s) 29
BstNI CCWGG 1 cut(s) 160
BstSCI CCNGG 1 cut(s) 158
BstUI CGCG 1 cut(s) 315
BtsCI GGATG 1 cut(s) 125
BtsI GCAGTG 1 cut(s) 291
BtsIMutI CAGTG 2 cut(s) 7, 291
Cac8I GCNNGC 1 cut(s) 268
CaiI CAGNNNCTG 1 cut(s) 140
CfoI GCGC 1 cut(s) 272
Cfr13I GGNCC 1 cut(s) 236
CviJI RGCY 3 cut(s) 251, 266, 289
CviKI_1 RGCY 3 cut(s) 251, 266, 289
Eam1104I CTCTTC 1 cut(s) 295
EarI CTCTTC 1 cut(s) 295
Eco47I GGWCC 1 cut(s) 236
Eco88I CYCGRG 1 cut(s) 38
EcoO109I RGGNCCY 1 cut(s) 236
EcoRI GAATTC 1 cut(s) 336
EcoRII CCWGG 1 cut(s) 158
FaiI YATR 5 cut(s) 30, 35, 84, 152, 185
FaqI GGGAC 3 cut(s) 130, 176, 222
FokI GGATG 1 cut(s) 112
FspBI CTAG 3 cut(s) 102, 267, 297
GlaI GCGC 1 cut(s) 271
HaeII RGCGCY 1 cut(s) 273
HhaI GCGC 1 cut(s) 272
Hin6I GCGC 1 cut(s) 270
HinP1I GCGC 1 cut(s) 270
HincII GTYRAC 2 cut(s) 228, 332
HindII GTYRAC 2 cut(s) 228, 332
HinfI GANTC 4 cut(s) 4, 98, 278, 319
HphI GGTGA 1 cut(s) 71
Hpy166II GTNNAC 2 cut(s) 228, 332
Hpy188I TCNGA 5 cut(s) 15, 217, 277, 342, 386
Hpy188III TCNNGA 2 cut(s) 102, 323
Hpy8I GTNNAC 2 cut(s) 228, 332
HpyAV CCTTC 3 cut(s) 61, 212, 299
HpyCH4III ACNGT 3 cut(s) 11, 49, 232
HpyCH4V TGCA 2 cut(s) 122, 209
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
HspAI GCGC 1 cut(s) 270
LpnPI CCDG 3 cut(s) 145, 172, 190
MaeI CTAG 3 cut(s) 102, 267, 297
MboII GAAGA 1 cut(s) 312
MluCI AATT 4 cut(s) 197, 204, 336, 368
MlyI GAGTC 1 cut(s) 107
MnlI CCTC 3 cut(s) 34, 283, 352
MseI TTAA 2 cut(s) 351, 377
MspR9I CCNGG 1 cut(s) 160
MvaI CCWGG 1 cut(s) 160
MvnI CGCG 1 cut(s) 315
MwoI GCNNNNNNNGC 1 cut(s) 29
NheI GCTAGC 1 cut(s) 266
NlaIV GGNNCC 1 cut(s) 238
PfeI GAWTC 3 cut(s) 4, 278, 319
PleI GAGTC 1 cut(s) 106
PpsI GAGTC 1 cut(s) 106
PpuMI RGGWCCY 1 cut(s) 236
Psp5II RGGWCCY 1 cut(s) 236
Psp6I CCWGG 1 cut(s) 158
PspGI CCWGG 1 cut(s) 158
PspN4I GGNNCC 1 cut(s) 238
PspPI GGNCC 1 cut(s) 236
PspPPI RGGWCCY 1 cut(s) 236
PstNI CAGNNNCTG 1 cut(s) 140
SaqAI TTAA 2 cut(s) 351, 377
Sau96I GGNCC 1 cut(s) 236
SchI GAGTC 1 cut(s) 107
ScrFI CCNGG 1 cut(s) 160
SetI ASST 4 cut(s) 223, 238, 268, 363
SinI GGWCC 1 cut(s) 236
Sse9I AATT 4 cut(s) 197, 204, 336, 368
SsiI CCGC 1 cut(s) 313
SspMI CTAG 3 cut(s) 102, 267, 297
StyD4I CCNGG 1 cut(s) 158
TaaI ACNGT 3 cut(s) 11, 49, 232
TasI AATT 4 cut(s) 197, 204, 336, 368
TfiI GAWTC 3 cut(s) 4, 278, 319
Tru1I TTAA 2 cut(s) 351, 377
Tru9I TTAA 2 cut(s) 351, 377
TscAI CASTG 2 cut(s) 14, 298
TspRI CASTG 2 cut(s) 14, 298
VpaK11BI GGWCC 1 cut(s) 236
XapI RAATTY 1 cut(s) 336
XbaI TCTAGA 1 cut(s) 101
XspI CTAG 3 cut(s) 102, 267, 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.