Rmu_sc0004550.1_g000013

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004550.1
Physical Location & Seq
Forward (+)
37066 .. 37716
651 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004550.1_g000013.1.cds

Sequence Viewer

Length: 651 bp
atgttcacactactcttctctttggccaccttgataatcctaccgccatctccgatcagtgcctcctctccatctgtttctgctctcttcgctttcggcgattccaccgtggattctggcatgaacaacgacctcatgcctttcgttcggtgcgaccatcccccttacggcagagacctgccggaacacggccccaccggaaggtactccaatggaaagattgcaactgactttatggcctcaaacttgggactcaaggacctcttgcctgcttacctcgacccgaaactgaccgactatgatttgctcaccggggtcagtttcgcgtcgggaacttgcggcctagatgatctgaccttggagttgagccacgtctatagtatgggggatcagttggagtattttgatgaagccgtagtgaggatgaagataagtgttggggaaaagaagggtagagagattgtggaaaatgcactgtttgtggttagtgttggggcgaatgacttgatgctgaacgtgtatgagtttcctctaaccgagaggaaaactcagtttacgtctacagaccagtactctgattttctgctccagagacttgggtcctttattcaggtaatgaatttcatctctttgtacatatacatatcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

216

Amino Acids

23.87

Weight (kDa)

4.48

Isoelectric Point (pI)

23.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013832)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 186
AccI GTMKAC 1 cut(s) 560
AccII CGCG 1 cut(s) 326
AciI CCGC 2 cut(s) 44, 339
AclWI GGATC 1 cut(s) 396
AcoI YGGCCR 1 cut(s) 24
AcsI RAATTY 1 cut(s) 619
AfaI GTAC 3 cut(s) 206, 572, 635
AfiI CCNNNNNNNGG 4 cut(s) 167, 188, 201, 420
AflIII ACRYGT 1 cut(s) 516
AjiI CACGTC 1 cut(s) 373
Alw26I GTCTC 2 cut(s) 168, 586
AlwI GGATC 1 cut(s) 396
AoxI GGCC 4 cut(s) 24, 190, 237, 340
ApoI RAATTY 1 cut(s) 619
AspS9I GGNCC 3 cut(s) 191, 259, 600
AsuC2I CCSGG 1 cut(s) 313
AsuHPI GGTGA 1 cut(s) 301
AvaII GGWCC 2 cut(s) 259, 600
BalI TGGCCA 1 cut(s) 26
BccI CCATC 3 cut(s) 55, 79, 165
BceAI ACGGC 3 cut(s) 184, 205, 398
BcnI CCSGG 1 cut(s) 313
BcoDI GTCTC 2 cut(s) 168, 586
BfaI CTAG 1 cut(s) 344
BfmI CTRYAG 2 cut(s) 376, 561
BfuAI ACCTGC 1 cut(s) 186
BisI GCNGC 1 cut(s) 340
BlsI GCNGC 1 cut(s) 341
BmcAI AGTACT 1 cut(s) 572
Bme1390I CCNGG 1 cut(s) 313
Bme18I GGWCC 2 cut(s) 259, 600
BmgBI CACGTC 1 cut(s) 373
BmgT120I GGNCC 3 cut(s) 191, 259, 600
BmiI GGNNCC 2 cut(s) 193, 601
BmrFI CCNGG 1 cut(s) 313
BmsI GCATC 1 cut(s) 498
BoxI GACNNNNGTC 1 cut(s) 598
BplI GAGNNNNNCTC 2 cut(s) 532, 564
BpmI CTGGAG 1 cut(s) 572
BpuEI CTTGAG 1 cut(s) 239
BpuMI CCSGG 1 cut(s) 313
BsaI GGTCTC 1 cut(s) 168
BsaJI CCNNGG 3 cut(s) 108, 312, 357
BsaWI WCCGGW 1 cut(s) 197
Bsc4I CCNNNNNNNGG 4 cut(s) 167, 188, 201, 420
Bse1I ACTGG 1 cut(s) 568
BseDI CCNNGG 3 cut(s) 108, 312, 357
BseGI GGATG 2 cut(s) 157, 429
BseLI CCNNNNNNNGG 4 cut(s) 167, 188, 201, 420
BseMII CTCAG 1 cut(s) 563
BseNI ACTGG 1 cut(s) 568
BseRI GAGGAG 1 cut(s) 55
Bsh1236I CGCG 1 cut(s) 326
BshFI GGCC 4 cut(s) 26, 192, 239, 342
BsiSI CCGG 3 cut(s) 182, 198, 312
BslFI GGGAC 1 cut(s) 264
BslI CCNNNNNNNGG 4 cut(s) 167, 188, 201, 420
BsmAI GTCTC 2 cut(s) 168, 586
BsmFI GGGAC 1 cut(s) 264
BsnI GGCC 4 cut(s) 26, 192, 239, 342
Bso31I GGTCTC 1 cut(s) 168
Bsp1407I TGTACA 1 cut(s) 633
Bsp143I GATC 3 cut(s) 54, 349, 388
BspACI CCGC 2 cut(s) 44, 339
BspANI GGCC 4 cut(s) 26, 192, 239, 342
BspCNI CTCAG 1 cut(s) 562
BspFNI CGCG 1 cut(s) 326
BspLI GGNNCC 2 cut(s) 193, 601
BspMI ACCTGC 1 cut(s) 186
BspPI GGATC 1 cut(s) 396
BspTNI GGTCTC 1 cut(s) 168
BsrGI TGTACA 1 cut(s) 633
BsrI ACTGG 1 cut(s) 568
BssECI CCNNGG 3 cut(s) 108, 312, 357
BssMI GATC 3 cut(s) 54, 349, 388
BssT1I CCWWGG 1 cut(s) 357
Bst4CI ACNGT 2 cut(s) 109, 477
Bst6I CTCTTC 2 cut(s) 20, 92
BstAUI TGTACA 1 cut(s) 633
BstC8I GCNNGC 1 cut(s) 270
BstDEI CTNAG 1 cut(s) 549
BstDSI CCRYGG 1 cut(s) 108
BstF5I GGATG 2 cut(s) 157, 429
BstFNI CGCG 1 cut(s) 326
BstKTI GATC 3 cut(s) 57, 352, 391
BstMAI GTCTC 2 cut(s) 168, 586
BstMBI GATC 3 cut(s) 54, 349, 388
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstPAI GACNNNNGTC 1 cut(s) 598
BstSCI CCNGG 1 cut(s) 311
BstSFI CTRYAG 2 cut(s) 376, 561
BstUI CGCG 1 cut(s) 326
BstXI CCANNNNNNTGG 1 cut(s) 596
BsuRI GGCC 4 cut(s) 26, 192, 239, 342
BtgI CCRYGG 1 cut(s) 108
BtrI CACGTC 1 cut(s) 373
BtsCI GGATG 2 cut(s) 157, 429
BtsIMutI CAGTG 2 cut(s) 64, 473
BveI ACCTGC 1 cut(s) 186
Cac8I GCNNGC 1 cut(s) 270
Cfr13I GGNCC 3 cut(s) 191, 259, 600
CseI GACGC 1 cut(s) 315
Csp6I GTAC 3 cut(s) 205, 571, 634
CviAII CATG 2 cut(s) 121, 136
CviJI RGCY 6 cut(s) 26, 192, 239, 342, 369, 413
CviKI_1 RGCY 6 cut(s) 26, 192, 239, 342, 369, 413
CviQI GTAC 3 cut(s) 205, 571, 634
DdeI CTNAG 1 cut(s) 549
DpnI GATC 3 cut(s) 56, 351, 390
DpnII GATC 3 cut(s) 54, 349, 388
EaeI YGGCCR 1 cut(s) 24
Eam1104I CTCTTC 2 cut(s) 20, 92
EarI CTCTTC 2 cut(s) 20, 92
Eco130I CCWWGG 1 cut(s) 357
Eco31I GGTCTC 1 cut(s) 168
Eco47I GGWCC 2 cut(s) 259, 600
EcoO109I RGGNCCY 2 cut(s) 259, 600
EcoT14I CCWWGG 1 cut(s) 357
ErhI CCWWGG 1 cut(s) 357
FaeI CATG 2 cut(s) 124, 139
FalI AAGNNNNNCTT 2 cut(s) 248, 280
FaqI GGGAC 1 cut(s) 264
FatI CATG 2 cut(s) 120, 135
FblI GTMKAC 1 cut(s) 560
Fnu4HI GCNGC 1 cut(s) 340
FokI GGATG 2 cut(s) 144, 436
Fsp4HI GCNGC 1 cut(s) 340
FspBI CTAG 1 cut(s) 344
GluI GCNGC 1 cut(s) 340
GsuI CTGGAG 1 cut(s) 572
HaeIII GGCC 4 cut(s) 26, 192, 239, 342
HapII CCGG 3 cut(s) 182, 198, 312
HgaI GACGC 1 cut(s) 315
Hin1II CATG 2 cut(s) 124, 139
HinfI GANTC 3 cut(s) 101, 113, 252
HpaII CCGG 3 cut(s) 182, 198, 312
HphI GGTGA 1 cut(s) 301
Hpy166II GTNNAC 3 cut(s) 6, 555, 561
Hpy188I TCNGA 3 cut(s) 54, 354, 577
Hpy188III TCNNGA 3 cut(s) 330, 589, 648
Hpy8I GTNNAC 3 cut(s) 6, 555, 561
Hpy99I CGWCG 1 cut(s) 331
HpyAV CCTTC 2 cut(s) 195, 442
HpyCH4III ACNGT 2 cut(s) 109, 477
HpyCH4IV ACGT 3 cut(s) 372, 516, 557
HpyCH4V TGCA 2 cut(s) 224, 473
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
HpyF3I CTNAG 1 cut(s) 549
HpySE526I ACGT 3 cut(s) 372, 516, 557
Hsp92II CATG 2 cut(s) 124, 139
Kzo9I GATC 3 cut(s) 54, 349, 388
LmnI GCTCC 1 cut(s) 591
LpnPI CCDG 9 cut(s) 102, 191, 195, 211, 282, 325, 581, 596, 602
LweI GCATC 1 cut(s) 498
MaeI CTAG 1 cut(s) 344
MaeII ACGT 3 cut(s) 372, 516, 557
MalI GATC 3 cut(s) 56, 351, 390
MboI GATC 3 cut(s) 54, 349, 388
MboII GAAGA 3 cut(s) 7, 79, 439
MlsI TGGCCA 1 cut(s) 26
MluCI AATT 1 cut(s) 619
MluNI TGGCCA 1 cut(s) 26
MlyI GAGTC 1 cut(s) 246
MmeI TCCRAC 1 cut(s) 375
MnlI CCTC 9 cut(s) 73, 76, 143, 250, 272, 287, 414, 534, 540
Mox20I TGGCCA 1 cut(s) 26
MscI TGGCCA 1 cut(s) 26
Msp20I TGGCCA 1 cut(s) 26
MspI CCGG 3 cut(s) 182, 198, 312
MspR9I CCNGG 1 cut(s) 313
MvnI CGCG 1 cut(s) 326
MwoI GCNNNNNNNGC 1 cut(s) 89
NciI CCSGG 1 cut(s) 313
NdeII GATC 3 cut(s) 54, 349, 388
NlaIII CATG 2 cut(s) 124, 139
NlaIV GGNNCC 2 cut(s) 193, 601
PcsI WCGNNNNNNNCGW 2 cut(s) 96, 150
PfeI GAWTC 2 cut(s) 101, 113
PkrI GCNGC 1 cut(s) 341
PleI GAGTC 1 cut(s) 246
PpsI GAGTC 1 cut(s) 246
PpuMI RGGWCCY 2 cut(s) 259, 600
PshAI GACNNNNGTC 1 cut(s) 598
Psp5II RGGWCCY 2 cut(s) 259, 600
PspN4I GGNNCC 2 cut(s) 193, 601
PspPI GGNCC 3 cut(s) 191, 259, 600
PspPPI RGGWCCY 2 cut(s) 259, 600
RsaI GTAC 3 cut(s) 206, 572, 635
RsaNI GTAC 3 cut(s) 205, 571, 634
SatI GCNGC 1 cut(s) 340
Sau3AI GATC 3 cut(s) 54, 349, 388
Sau96I GGNCC 3 cut(s) 191, 259, 600
ScaI AGTACT 1 cut(s) 572
SchI GAGTC 1 cut(s) 246
ScrFI CCNGG 1 cut(s) 313
SfaNI GCATC 1 cut(s) 498
SfcI CTRYAG 2 cut(s) 376, 561
SinI GGWCC 2 cut(s) 259, 600
SmlI CTYRAG 1 cut(s) 254
SmoI CTYRAG 1 cut(s) 254
Sse9I AATT 1 cut(s) 619
SsiI CCGC 2 cut(s) 44, 339
SspMI CTAG 1 cut(s) 344
StyD4I CCNGG 1 cut(s) 311
StyI CCWWGG 1 cut(s) 357
TaaI ACNGT 2 cut(s) 109, 477
TaiI ACGT 3 cut(s) 375, 519, 560
TaqI TCGA 1 cut(s) 279
TaqII GACCGA 1 cut(s) 308
TasI AATT 1 cut(s) 619
TatI WGTACW 2 cut(s) 570, 633
TauI GCSGC 1 cut(s) 342
TfiI GAWTC 2 cut(s) 101, 113
TscAI CASTG 2 cut(s) 64, 480
TspDTI ATGAA 5 cut(s) 137, 423, 440, 613, 632
TspRI CASTG 2 cut(s) 64, 480
VpaK11BI GGWCC 2 cut(s) 259, 600
XapI RAATTY 1 cut(s) 619
XmiI GTMKAC 1 cut(s) 560
XspI CTAG 1 cut(s) 344
ZrmI AGTACT 1 cut(s) 572
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.